Incidental Mutation 'R5166:Slc1a6'
ID397312
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5166 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 78796269 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490] [ENSMUST00000005490] [ENSMUST00000005490] [ENSMUST00000217717]
Predicted Effect probably null
Transcript: ENSMUST00000005490
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000005490
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000005490
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217717
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,600,020 T435A probably benign Het
Adcy3 T A 12: 4,134,438 I38N probably damaging Het
Aff1 A G 5: 103,754,657 probably benign Het
Asxl1 A G 2: 153,401,121 E1197G probably damaging Het
Brinp3 T A 1: 146,901,367 N517K probably damaging Het
Carmil1 C T 13: 24,154,983 probably null Het
Ccdc185 G A 1: 182,748,999 Q42* probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh10 A G 15: 19,013,360 E682G probably damaging Het
Col6a3 C A 1: 90,810,608 R456L probably damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Flt4 T C 11: 49,633,257 probably null Het
Fstl5 A C 3: 76,628,960 K26Q possibly damaging Het
Gk5 G T 9: 96,174,768 A413S probably damaging Het
Glcci1 T A 6: 8,537,854 S157R probably benign Het
Gzmc G A 14: 56,233,976 A36V probably damaging Het
Hexb T C 13: 97,182,004 N283S probably benign Het
Hydin A G 8: 110,523,142 E2239G possibly damaging Het
Igkv10-95 A T 6: 68,680,560 Y20F probably benign Het
Il17re A G 6: 113,462,962 T181A probably benign Het
Kcnh6 G A 11: 106,020,319 A514T possibly damaging Het
Kcnk10 G A 12: 98,434,995 R460W probably damaging Het
Krtap5-2 A T 7: 142,174,984 S320T unknown Het
Larp1b G T 3: 40,964,052 E24* probably null Het
Mettl22 A G 16: 8,478,251 T135A probably benign Het
Mlh1 A G 9: 111,241,513 V378A probably benign Het
Mmrn1 A T 6: 60,976,490 H585L probably benign Het
Myh14 A G 7: 44,628,855 F1024L probably damaging Het
Nbea A T 3: 56,019,453 H776Q probably damaging Het
Nod2 A G 8: 88,664,247 D372G possibly damaging Het
Nptn C T 9: 58,618,980 R137* probably null Het
Olfr825 T C 10: 130,162,561 Y255C possibly damaging Het
Pm20d2 C T 4: 33,181,803 V267I probably benign Het
Rassf10 A G 7: 112,954,420 D76G probably benign Het
Rbbp5 A G 1: 132,490,565 T41A possibly damaging Het
Rttn T C 18: 89,013,094 V643A possibly damaging Het
Sbno2 C A 10: 80,066,928 E421* probably null Het
Slc17a3 T C 13: 23,842,542 probably null Het
Slco2b1 A G 7: 99,689,013 S106P possibly damaging Het
Spef1 T C 2: 131,174,591 N28S probably damaging Het
Srebf2 C A 15: 82,185,402 T675N probably damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tbcd T A 11: 121,609,390 L1114H possibly damaging Het
Tex15 T C 8: 33,576,392 V1950A probably benign Het
Tnfsf9 T A 17: 57,106,263 F148Y possibly damaging Het
Traf6 A G 2: 101,690,057 D150G probably benign Het
Ttn A G 2: 76,863,373 Y262H possibly damaging Het
Unc93b1 A G 19: 3,944,027 Y386C probably damaging Het
Vmn1r226 A T 17: 20,687,863 E119V probably benign Het
Wrn A T 8: 33,352,072 probably null Het
Zfp398 A G 6: 47,865,904 I165V probably benign Het
Zfp850 A T 7: 27,990,356 C142* probably null Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7166:Slc1a6 UTSW 10 78812812 missense possibly damaging 0.96
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CTTTGAGGAGACTGTGCCTG -3'
(R):5'- CTCTGAGACAATGCACAAATGAG -3'

Sequencing Primer
(F):5'- AGGAGACTGTGCCTGTACCTG -3'
(R):5'- TAGGTTGAGGTCATGAACAGATG -3'
Posted On2016-07-06