Incidental Mutation 'R5181:Dcdc2a'
ID397564
Institutional Source Beutler Lab
Gene Symbol Dcdc2a
Ensembl Gene ENSMUSG00000035910
Gene Namedoublecortin domain containing 2a
SynonymsRU2, Dcdc2
MMRRC Submission 042761-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R5181 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location25056004-25210706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25202364 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 407 (T407K)
Ref Sequence ENSEMBL: ENSMUSP00000063650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069614
AA Change: T407K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063650
Gene: ENSMUSG00000035910
AA Change: T407K

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
coiled coil region 409 437 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160363
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired short term object recognition, impaired visuo-spatial learning and memory and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,714,937 D642E probably benign Het
Anxa2 T C 9: 69,476,065 V54A probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdca2 A G 14: 67,680,165 S595P probably damaging Het
Cenpe G A 3: 135,242,303 E1208K probably damaging Het
Cfh T C 1: 140,147,646 probably benign Het
Colq T A 14: 31,557,842 H9L probably benign Het
Coq8b T C 7: 27,252,322 I403T possibly damaging Het
Fam198b A T 3: 79,886,311 S29C probably benign Het
Fam49b T A 15: 63,938,677 M234L probably damaging Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Inpp5f A G 7: 128,679,831 T519A probably damaging Het
Isl2 G T 9: 55,542,277 R79L probably benign Het
Kif9 T A 9: 110,521,268 D742E probably damaging Het
Lgi2 T A 5: 52,554,450 K176M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrch4 A G 5: 137,629,403 D66G probably damaging Het
Milr1 G A 11: 106,754,980 G116D probably damaging Het
Myof T C 19: 37,932,623 D1397G possibly damaging Het
Neurod2 T C 11: 98,327,378 H320R probably benign Het
Nox3 A T 17: 3,635,286 Y562* probably null Het
Nrap G A 19: 56,345,528 H884Y possibly damaging Het
Pde3a T C 6: 141,481,255 probably null Het
Pgm2l1 G A 7: 100,261,758 C303Y probably benign Het
Phip A G 9: 82,871,190 probably benign Het
Plxna4 A G 6: 32,516,997 I228T probably damaging Het
Prdm2 A G 4: 143,134,966 S585P probably benign Het
Prpf6 T C 2: 181,649,546 I718T probably damaging Het
Rpp40 T C 13: 35,896,712 probably null Het
Skiv2l T C 17: 34,844,826 D547G probably benign Het
Slc22a22 T A 15: 57,255,123 Y264F probably benign Het
Slc5a4b A T 10: 76,060,387 L578* probably null Het
Sptan1 A T 2: 29,993,724 probably benign Het
St5 T C 7: 109,556,790 Y251C probably benign Het
Sult2a4 T G 7: 13,988,391 I50L probably benign Het
Taar6 T C 10: 23,984,785 T288A possibly damaging Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tmem98 T C 11: 80,819,932 V139A probably damaging Het
Triobp T C 15: 78,967,754 Y703H probably benign Het
Ttc25 G A 11: 100,549,893 D67N probably damaging Het
Ttc34 A G 4: 154,862,246 T868A probably benign Het
Ttn C T 2: 76,834,881 probably benign Het
Vipas39 A T 12: 87,239,827 W470R probably damaging Het
Vmn2r102 T C 17: 19,676,741 Y117H probably benign Het
Vmn2r111 T C 17: 22,571,020 N335S possibly damaging Het
Vmn2r70 A G 7: 85,559,179 Y697H probably damaging Het
Wnk4 C A 11: 101,265,377 R461S probably damaging Het
Xylb T A 9: 119,364,501 L87Q probably damaging Het
Zcchc9 T A 13: 91,797,162 K101* probably null Het
Zfp503 C A 14: 21,985,637 A404S probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Other mutations in Dcdc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Dcdc2a APN 13 25119329 missense probably benign 0.00
IGL01314:Dcdc2a APN 13 25102604 missense probably damaging 1.00
IGL02171:Dcdc2a APN 13 25056434 missense probably damaging 1.00
IGL02490:Dcdc2a APN 13 25107652 missense probably damaging 1.00
R0128:Dcdc2a UTSW 13 25187672 splice site probably benign
R0130:Dcdc2a UTSW 13 25187672 splice site probably benign
R0366:Dcdc2a UTSW 13 25056434 missense probably damaging 1.00
R0507:Dcdc2a UTSW 13 25102589 missense probably damaging 0.99
R0514:Dcdc2a UTSW 13 25119386 missense probably benign 0.04
R1055:Dcdc2a UTSW 13 25102610 missense probably damaging 0.99
R1170:Dcdc2a UTSW 13 25056307 missense probably benign 0.34
R1301:Dcdc2a UTSW 13 25102586 missense possibly damaging 0.93
R1514:Dcdc2a UTSW 13 25061254 missense probably benign 0.05
R1842:Dcdc2a UTSW 13 25107602 missense probably damaging 1.00
R2060:Dcdc2a UTSW 13 25107710 missense possibly damaging 0.59
R2121:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2122:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2900:Dcdc2a UTSW 13 25120498 missense probably benign 0.01
R3153:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R3154:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R4353:Dcdc2a UTSW 13 25056491 missense probably damaging 1.00
R4608:Dcdc2a UTSW 13 25061240 nonsense probably null
R5099:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R5128:Dcdc2a UTSW 13 25102529 missense probably damaging 1.00
R5271:Dcdc2a UTSW 13 25187688 missense probably benign 0.35
R5869:Dcdc2a UTSW 13 25107730 missense probably benign 0.05
R6058:Dcdc2a UTSW 13 25056371 missense possibly damaging 0.82
R6146:Dcdc2a UTSW 13 25205457 missense probably benign 0.35
R6892:Dcdc2a UTSW 13 25056460 missense probably damaging 1.00
R6956:Dcdc2a UTSW 13 25119366 missense probably benign 0.02
R6972:Dcdc2a UTSW 13 25120389 intron probably benign
R6973:Dcdc2a UTSW 13 25120389 intron probably benign
R7097:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R7247:Dcdc2a UTSW 13 25102391 missense probably benign 0.00
R7390:Dcdc2a UTSW 13 25107617 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTTGCTTCTTAAGAGGCCAGC -3'
(R):5'- CTGCAGATTCTAAGTGTTTGGC -3'

Sequencing Primer
(F):5'- CTTCTTAAGAGGCCAGCAGAAATAG -3'
(R):5'- GCTACTGTTTTAAGCACATTCGTG -3'
Posted On2016-07-06