Incidental Mutation 'R5182:Pdc'
ID397582
Institutional Source Beutler Lab
Gene Symbol Pdc
Ensembl Gene ENSMUSG00000006007
Gene Namephosducin
SynonymsPdc, Rpr1, Rpr-1
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150319417-150333906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150333354 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 196 (I196T)
Ref Sequence ENSEMBL: ENSMUSP00000141136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165062] [ENSMUST00000185698] [ENSMUST00000186572] [ENSMUST00000191228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165062
AA Change: I196T

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131631
Gene: ENSMUSG00000006007
AA Change: I196T

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185698
SMART Domains Protein: ENSMUSP00000140669
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 79 2.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186460
Predicted Effect probably benign
Transcript: ENSMUST00000186572
SMART Domains Protein: ENSMUSP00000140843
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 185 1.6e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191228
AA Change: I196T

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141136
Gene: ENSMUSG00000006007
AA Change: I196T

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal retinal morphology and rod function with reduced transducin (Gnat1) translocation. Mice homozygous for a different knock-out allele exhibit large pupils, increased blood pressure, age-related vascular smooth muscle hypertrophy, and stress-induced hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Pdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Pdc APN 1 150333255 missense probably damaging 0.99
IGL02537:Pdc APN 1 150333009 missense possibly damaging 0.68
R0349:Pdc UTSW 1 150333427 missense probably benign 0.07
R0502:Pdc UTSW 1 150328414 splice site probably benign
R1167:Pdc UTSW 1 150333245 missense probably damaging 1.00
R1717:Pdc UTSW 1 150333141 missense probably damaging 1.00
R5449:Pdc UTSW 1 150333439 missense probably damaging 1.00
R5766:Pdc UTSW 1 150333500 makesense probably null
R6020:Pdc UTSW 1 150333366 missense probably benign 0.16
R6181:Pdc UTSW 1 150333270 missense probably damaging 1.00
R6425:Pdc UTSW 1 150333372 missense probably benign 0.37
R6660:Pdc UTSW 1 150333335 missense probably damaging 1.00
R6717:Pdc UTSW 1 150333018 missense probably damaging 1.00
R6925:Pdc UTSW 1 150333180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGCAATTCCTGGAAACC -3'
(R):5'- TAGACATGAGATACTGACATGGTG -3'

Sequencing Primer
(F):5'- TTCCTGGAAACCATCGAGAAG -3'
(R):5'- GAAGGCTTATTCAATGTCCTCG -3'
Posted On2016-07-06