Incidental Mutation 'R5182:Eng'
ID397585
Institutional Source Beutler Lab
Gene Symbol Eng
Ensembl Gene ENSMUSG00000026814
Gene Nameendoglin
SynonymsCD105, Endo
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32646595-32682669 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 32672959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000113272] [ENSMUST00000167841]
Predicted Effect probably null
Transcript: ENSMUST00000009705
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113272
SMART Domains Protein: ENSMUSP00000108897
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
ZP 361 568 1.29e-2 SMART
transmembrane domain 586 608 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156306
SMART Domains Protein: ENSMUSP00000122186
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
ZP 52 283 1.23e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167841
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196848
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted null mutations show defective vascular development, extra-arterial hematopoiesis, cardiac defects and die by embryonic day 11.0. Heterozygotes develop hemorrhagic telangiectasia causing strokes, fatal hemorrhage and heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Eng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Eng APN 2 32672382 missense probably benign 0.03
IGL01432:Eng APN 2 32669532 missense possibly damaging 0.66
IGL02203:Eng APN 2 32671486 missense probably benign 0.35
IGL02330:Eng APN 2 32669569 splice site probably null
IGL02633:Eng APN 2 32673274 missense probably damaging 0.99
IGL02747:Eng APN 2 32672958 critical splice donor site probably null
R0008:Eng UTSW 2 32677680 missense probably damaging 0.97
R0149:Eng UTSW 2 32672385 critical splice donor site probably null
R0206:Eng UTSW 2 32678993 missense probably benign 0.15
R0208:Eng UTSW 2 32678993 missense probably benign 0.15
R0360:Eng UTSW 2 32679137 missense probably benign 0.27
R0364:Eng UTSW 2 32679137 missense probably benign 0.27
R1399:Eng UTSW 2 32673322 missense probably damaging 0.98
R1520:Eng UTSW 2 32672941 missense probably benign 0.41
R1752:Eng UTSW 2 32673392 missense probably benign
R2162:Eng UTSW 2 32679047 missense probably damaging 1.00
R2201:Eng UTSW 2 32673740 splice site probably benign
R2389:Eng UTSW 2 32657672 critical splice donor site probably null
R3021:Eng UTSW 2 32678568 missense probably damaging 1.00
R3428:Eng UTSW 2 32657533 missense probably damaging 0.97
R4704:Eng UTSW 2 32678912 missense probably benign 0.00
R5024:Eng UTSW 2 32673392 missense probably benign 0.00
R5130:Eng UTSW 2 32681506 missense probably damaging 1.00
R6270:Eng UTSW 2 32673643 missense probably benign 0.26
R6790:Eng UTSW 2 32669445 missense probably damaging 0.99
R6872:Eng UTSW 2 32673275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCCCCATACTAAAGCC -3'
(R):5'- TGGCATCTTACCTACGGAGAC -3'

Sequencing Primer
(F):5'- TCTGTCCCCATACTAAAGCCACAAC -3'
(R):5'- GACCCAGCTCAGAGTTTGTATC -3'
Posted On2016-07-06