Incidental Mutation 'R5182:Usp10'
ID397619
Institutional Source Beutler Lab
Gene Symbol Usp10
Ensembl Gene ENSMUSG00000031826
Gene Nameubiquitin specific peptidase 10
SynonymsUchrp, 2610014N07Rik
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119910360-119957560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119956681 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 764 (V764I)
Ref Sequence ENSEMBL: ENSMUSP00000104616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108982] [ENSMUST00000108988] [ENSMUST00000127664] [ENSMUST00000144458]
Predicted Effect probably benign
Transcript: ENSMUST00000108982
SMART Domains Protein: ENSMUSP00000104610
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
Pfam:UCH 9 113 1.6e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108988
AA Change: V764I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104616
Gene: ENSMUSG00000031826
AA Change: V764I

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
low complexity region 147 155 N/A INTRINSIC
Pfam:UCH 408 786 9.3e-48 PFAM
Pfam:UCH_1 409 764 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125066
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect silent
Transcript: ENSMUST00000134729
SMART Domains Protein: ENSMUSP00000134182
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143615
Predicted Effect possibly damaging
Transcript: ENSMUST00000144458
AA Change: V765I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123590
Gene: ENSMUSG00000031826
AA Change: V765I

DomainStartEndE-ValueType
Pfam:PAM2 78 95 1.1e-7 PFAM
low complexity region 118 132 N/A INTRINSIC
low complexity region 148 156 N/A INTRINSIC
Pfam:UCH 409 787 1.2e-44 PFAM
Pfam:UCH_1 410 765 4.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148767
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in arsenite-induced stress granule formation, reactive oxygen species (ROS) production, and ROS-dependent apoptosis in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Pnma1 T C 12: 84,147,045 I295V probably benign Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Usp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Usp10 APN 8 119948741 missense possibly damaging 0.95
IGL02444:Usp10 APN 8 119948693 missense possibly damaging 0.70
IGL02487:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02526:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02951:Usp10 APN 8 119947086 missense probably benign 0.01
IGL03003:Usp10 APN 8 119954810 missense possibly damaging 0.90
IGL03049:Usp10 APN 8 119956627 missense probably benign 0.01
PIT4585001:Usp10 UTSW 8 119954892 missense probably benign 0.02
R0090:Usp10 UTSW 8 119953196 nonsense probably null
R0329:Usp10 UTSW 8 119936557 nonsense probably null
R0550:Usp10 UTSW 8 119947801 missense probably damaging 0.98
R2349:Usp10 UTSW 8 119956709 makesense probably null
R4345:Usp10 UTSW 8 119954814 missense probably damaging 1.00
R4782:Usp10 UTSW 8 119941191 missense probably benign 0.03
R5184:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5461:Usp10 UTSW 8 119956667 missense probably benign 0.44
R5749:Usp10 UTSW 8 119941133 missense probably damaging 0.99
R5873:Usp10 UTSW 8 119947092 missense possibly damaging 0.60
R5935:Usp10 UTSW 8 119947089 missense possibly damaging 0.74
R6242:Usp10 UTSW 8 119941838 missense probably benign 0.01
R6362:Usp10 UTSW 8 119941316 missense probably benign 0.00
R6608:Usp10 UTSW 8 119948422 missense probably benign 0.06
R6774:Usp10 UTSW 8 119951972 missense probably benign
R7148:Usp10 UTSW 8 119936550 missense possibly damaging 0.47
R7164:Usp10 UTSW 8 119942108 missense probably damaging 1.00
R7238:Usp10 UTSW 8 119941544 missense probably benign
R7310:Usp10 UTSW 8 119941605 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTCCACCTGAGTCAGTAGC -3'
(R):5'- TCTACAGAGCCACTAGAGAGG -3'

Sequencing Primer
(F):5'- ACCTGAGTCAGTAGCCTGCAG -3'
(R):5'- CACTAGAGAGGTGGGTAGTGAGTG -3'
Posted On2016-07-06