Incidental Mutation 'R5182:Pnma1'
ID397630
Institutional Source Beutler Lab
Gene Symbol Pnma1
Ensembl Gene ENSMUSG00000054383
Gene Nameparaneoplastic antigen MA1
Synonyms
MMRRC Submission 042853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5182 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84146131-84148489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84147045 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 295 (I295V)
Ref Sequence ENSEMBL: ENSMUSP00000060783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000061425] [ENSMUST00000110294] [ENSMUST00000123491]
Predicted Effect probably benign
Transcript: ENSMUST00000046266
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061425
AA Change: I295V

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060783
Gene: ENSMUSG00000054383
AA Change: I295V

DomainStartEndE-ValueType
Pfam:PNMA 1 326 6e-143 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110294
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123491
SMART Domains Protein: ENSMUSP00000121038
Gene: ENSMUSG00000042523

DomainStartEndE-ValueType
Pfam:LRR_4 93 135 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143711
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuron- and testis-specific protein that is also expressed in some paraneoplastic syndromes affecting the nervous system. Some patients with neurologic disorders develop antibodies against the protein encoded by this gene. The identification of the antineuronal antibodies in the sera of these patients has facilitated the diagnosis of paraneoplastic neurological disorders and the early detection of the associated tumors. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A G 19: 21,630,765 M1T probably null Het
Abcg8 T C 17: 84,692,744 L243P probably damaging Het
Ankrd27 A G 7: 35,628,487 T811A probably damaging Het
Auts2 T C 5: 131,475,081 N188S probably null Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Cep350 A C 1: 155,858,108 L3013R probably damaging Het
Clca3b A G 3: 144,828,015 I533T probably damaging Het
Col6a5 C A 9: 105,857,332 E2637* probably null Het
Coq5 G A 5: 115,279,756 R15H probably benign Het
Dnah5 T G 15: 28,311,278 I1801S probably damaging Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dpf3 T C 12: 83,370,596 E34G probably damaging Het
Dst C A 1: 34,179,086 Q1536K probably benign Het
Eng T C 2: 32,672,959 probably null Het
Fam102b T C 3: 108,985,351 K173E possibly damaging Het
Fignl1 A T 11: 11,801,717 I446N probably damaging Het
Fras1 C A 5: 96,636,173 C845* probably null Het
Gfm2 T C 13: 97,162,893 V347A probably damaging Het
Gpld1 A T 13: 24,984,070 probably null Het
Grn C A 11: 102,430,554 probably benign Het
Gsdmc4 C A 15: 63,893,804 V299F probably damaging Het
Hrnr A T 3: 93,332,143 R3229S unknown Het
Icam5 A G 9: 21,034,810 T313A probably benign Het
Ift172 T A 5: 31,267,614 D668V possibly damaging Het
Kdm5a T A 6: 120,388,105 C322* probably null Het
Klk6 A G 7: 43,828,660 K152R probably benign Het
Man1a2 A C 3: 100,647,017 I250S probably damaging Het
Nkpd1 A G 7: 19,523,256 Y170C probably damaging Het
Nmd3 T A 3: 69,722,468 probably null Het
Olfr131 A G 17: 38,082,114 M288T probably benign Het
Olfr566 A T 7: 102,856,969 D104E probably benign Het
Pax4 C T 6: 28,444,369 E229K probably benign Het
Pdc T C 1: 150,333,354 I196T possibly damaging Het
Pld1 T C 3: 28,045,081 I299T probably damaging Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Psmd12 T C 11: 107,479,659 L28P probably damaging Het
Ptprg A G 14: 12,154,174 T632A probably benign Het
Rab43 A G 6: 87,794,655 *118R probably null Het
Rabep1 C T 11: 70,904,628 R227* probably null Het
Rad51c T G 11: 87,397,719 I213L possibly damaging Het
Ranbp17 A T 11: 33,219,287 probably benign Het
Ryr3 T C 2: 112,755,150 E2735G probably damaging Het
Sdc3 A G 4: 130,821,684 probably benign Het
Sirpa G A 2: 129,615,732 R242H possibly damaging Het
Slc12a4 G A 8: 105,944,606 T983M probably damaging Het
Snx7 A G 3: 117,832,857 Y252H probably damaging Het
St18 C T 1: 6,817,653 T482I probably benign Het
St7 A G 6: 17,846,237 Y163C probably damaging Het
Tas2r137 A T 6: 40,491,932 Q232L probably benign Het
Tgm6 A T 2: 130,141,302 K270N probably damaging Het
Tiam2 G A 17: 3,438,721 G768D probably damaging Het
Ttn C T 2: 76,870,429 probably benign Het
Ube4b A C 4: 149,381,242 S250R probably null Het
Ubxn2a G A 12: 4,880,634 A242V probably damaging Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Vmn1r222 A G 13: 23,232,497 L182P probably damaging Het
Vmn2r114 A G 17: 23,291,658 V616A probably damaging Het
Vps13a A G 19: 16,695,499 V1303A possibly damaging Het
Wnk2 G T 13: 49,061,161 T1315K possibly damaging Het
Zfp936 G A 7: 43,189,907 C266Y probably damaging Het
Zscan20 G T 4: 128,586,711 N662K possibly damaging Het
Other mutations in Pnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4589:Pnma1 UTSW 12 84147461 missense probably benign 0.00
R4748:Pnma1 UTSW 12 84147723 missense probably benign 0.07
R5763:Pnma1 UTSW 12 84147350 missense possibly damaging 0.66
R6528:Pnma1 UTSW 12 84147423 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATATCAAAAGCAGCCTGGCC -3'
(R):5'- TGAAGGCTCTTGAGCAGGTC -3'

Sequencing Primer
(F):5'- TCCTAGGACTCAGAAGTGCC -3'
(R):5'- AAGGCTCTTGAGCAGGTCTTTGG -3'
Posted On2016-07-06