Incidental Mutation 'R5183:Ncoa2'
ID397645
Institutional Source Beutler Lab
Gene Symbol Ncoa2
Ensembl Gene ENSMUSG00000005886
Gene Namenuclear receptor coactivator 2
SynonymsSRC-2, TIF2, glucocorticoid receptor-interacting protein 1, D1Ertd433e, KAT13C, bHLHe75, TIF2/GRIP-1, TIF-2, Grip1
MMRRC Submission 042762-MU
Accession Numbers

Ncbi RefSeq: NM_008678.2, NM_001077695.1; MGI: 1276533

Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13139105-13374083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13174366 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 703 (L703V)
Ref Sequence ENSEMBL: ENSMUSP00000080413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006037] [ENSMUST00000068304] [ENSMUST00000081713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006037
AA Change: L703V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006037
Gene: ENSMUSG00000005886
AA Change: L703V

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:NCOA_u2 463 587 6.7e-39 PFAM
Pfam:SRC-1 636 709 5.8e-23 PFAM
Pfam:DUF4927 731 816 2.7e-33 PFAM
low complexity region 1021 1037 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1071 1117 6.5e-27 PFAM
low complexity region 1183 1204 N/A INTRINSIC
low complexity region 1243 1264 N/A INTRINSIC
DUF1518 1279 1336 5.92e-28 SMART
low complexity region 1409 1420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068304
AA Change: L703V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069509
Gene: ENSMUSG00000005886
AA Change: L703V

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081713
AA Change: L703V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080413
Gene: ENSMUSG00000005886
AA Change: L703V

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195493
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype Strain: 2183803
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a transcriptional coactivator for nuclear hormone receptors, including steroid, thyroid, retinoid, and vitamin D receptors. The encoded protein acts as an intermediary factor for the ligand-dependent activity of these nuclear receptors, which regulate their target genes upon binding of cognate response elements. This gene has been found to be involved in translocations that result in fusions with other genes in various cancers, including the lysine acetyltransferase 6A (KAT6A) gene in acute myeloid leukemia, the ETS variant 6 (ETV6) gene in acute lymphoblastic leukemia, and the hes related family bHLH transcription factor with YRPW motif 1 (HEY1) gene in mesenchymal chondrosarcoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice exhibit a transient postnatal growth deficiency and hypofertility. Male hypofertility is due to defects in spermiogenesis and an age-dependent testicular degeneration preceded by defective lipid metabolism in Sertoli cells. Female hypofertility is due to a placental hypoplasia. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted(4) Gene trapped(39)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Ncoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Ncoa2 APN 1 13149079 missense possibly damaging 0.91
IGL01469:Ncoa2 APN 1 13186869 missense probably benign 0.02
IGL01735:Ncoa2 APN 1 13164903 missense probably benign 0.01
IGL01799:Ncoa2 APN 1 13152375 splice site probably benign
IGL02023:Ncoa2 APN 1 13174854 missense probably damaging 1.00
IGL02115:Ncoa2 APN 1 13152817 missense probably damaging 1.00
IGL02263:Ncoa2 APN 1 13174763 missense probably damaging 1.00
IGL03131:Ncoa2 APN 1 13177174 missense probably damaging 0.98
IGL03189:Ncoa2 APN 1 13190136 missense probably damaging 1.00
IGL03240:Ncoa2 APN 1 13177092 missense probably damaging 1.00
R0017:Ncoa2 UTSW 1 13174752 missense probably damaging 1.00
R0056:Ncoa2 UTSW 1 117516497 critical splice donor site probably null
R0158:Ncoa2 UTSW 1 13152384 missense probably benign 0.05
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0684:Ncoa2 UTSW 1 13224651 missense probably damaging 0.99
R0788:Ncoa2 UTSW 1 13166889 splice site probably benign
R1433:Ncoa2 UTSW 1 13148378 missense probably benign 0.01
R1517:Ncoa2 UTSW 1 13165057 missense probably benign 0.33
R1799:Ncoa2 UTSW 1 13162293 splice site probably null
R1959:Ncoa2 UTSW 1 13160252 missense probably damaging 1.00
R2034:Ncoa2 UTSW 1 13164983 missense probably benign 0.00
R2175:Ncoa2 UTSW 1 13224613 missense probably damaging 0.96
R2437:Ncoa2 UTSW 1 13148360 missense probably damaging 0.98
R2851:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R2853:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R4334:Ncoa2 UTSW 1 13174963 missense possibly damaging 0.77
R4365:Ncoa2 UTSW 1 13180547 missense probably damaging 0.96
R4386:Ncoa2 UTSW 1 13177165 missense probably damaging 0.99
R4516:Ncoa2 UTSW 1 13146906 missense probably damaging 0.99
R5109:Ncoa2 UTSW 1 13186846 missense probably damaging 1.00
R5162:Ncoa2 UTSW 1 13175172 missense possibly damaging 0.79
R5250:Ncoa2 UTSW 1 13224689 missense probably damaging 1.00
R5514:Ncoa2 UTSW 1 13181221 missense probably damaging 1.00
R5691:Ncoa2 UTSW 1 13180550 missense probably damaging 0.99
R5837:Ncoa2 UTSW 1 13224706 utr 5 prime probably benign
R6003:Ncoa2 UTSW 1 13167030 missense possibly damaging 0.81
R6134:Ncoa2 UTSW 1 13174371 missense probably damaging 1.00
R6559:Ncoa2 UTSW 1 13150617 intron probably null
R6623:Ncoa2 UTSW 1 13181297 missense probably damaging 0.99
R6949:Ncoa2 UTSW 1 13156501 missense possibly damaging 0.92
R7090:Ncoa2 UTSW 1 13186838 missense probably damaging 1.00
R7251:Ncoa2 UTSW 1 13148375 missense probably benign 0.01
X0063:Ncoa2 UTSW 1 13175238 missense possibly damaging 0.82
X0066:Ncoa2 UTSW 1 13148449 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTTACTGTCCAGTCGCTCGAG -3'
(R):5'- AGACCAAACTCCTGCAGCTG -3'

Sequencing Primer
(F):5'- GGGGTTATTTCCGGTAAACCAATATC -3'
(R):5'- AACTCCTGCAGCTGCTGAC -3'
Posted On2016-07-06