Incidental Mutation 'R5183:Orc2'
ID397646
Institutional Source Beutler Lab
Gene Symbol Orc2
Ensembl Gene ENSMUSG00000026037
Gene Nameorigin recognition complex, subunit 2
SynonymsOrc2l
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58462771-58505109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58474818 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 298 (S298R)
Ref Sequence ENSEMBL: ENSMUSP00000109964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000114337]
Predicted Effect probably benign
Transcript: ENSMUST00000027198
AA Change: S346R

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: S346R

DomainStartEndE-ValueType
low complexity region 176 201 N/A INTRINSIC
Pfam:ORC2 254 563 2.5e-110 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114325
AA Change: S298R

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037
AA Change: S298R

DomainStartEndE-ValueType
low complexity region 128 153 N/A INTRINSIC
Pfam:ORC2 206 517 1.2e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114337
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Orc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Orc2 APN 1 58493716 missense possibly damaging 0.81
IGL00549:Orc2 APN 1 58481042 missense probably benign 0.00
IGL01343:Orc2 APN 1 58492855 critical splice donor site probably null
IGL01357:Orc2 APN 1 58497392 missense probably benign 0.26
IGL01357:Orc2 APN 1 58497393 missense probably benign 0.00
IGL02167:Orc2 APN 1 58483639 unclassified probably benign
IGL02343:Orc2 APN 1 58469666 critical splice donor site probably null
IGL02548:Orc2 APN 1 58466122 unclassified probably benign
R0557:Orc2 UTSW 1 58469687 missense probably damaging 1.00
R1470:Orc2 UTSW 1 58481158 unclassified probably benign
R1886:Orc2 UTSW 1 58471088 critical splice acceptor site probably null
R2065:Orc2 UTSW 1 58469695 missense probably damaging 1.00
R3848:Orc2 UTSW 1 58480992 missense probably benign 0.08
R4389:Orc2 UTSW 1 58474861 missense probably benign 0.21
R4393:Orc2 UTSW 1 58467650 critical splice donor site probably null
R4613:Orc2 UTSW 1 58500309 nonsense probably null
R5652:Orc2 UTSW 1 58466072 missense probably damaging 0.99
R5793:Orc2 UTSW 1 58497388 start codon destroyed probably null 0.27
R5997:Orc2 UTSW 1 58472388 missense probably damaging 1.00
R6007:Orc2 UTSW 1 58467692 missense probably benign 0.03
R6330:Orc2 UTSW 1 58500334 missense probably benign
R6656:Orc2 UTSW 1 58493659 critical splice donor site probably null
R6923:Orc2 UTSW 1 58500375 missense probably benign 0.01
R6934:Orc2 UTSW 1 58500364 missense probably benign 0.28
Z1088:Orc2 UTSW 1 58476516 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGACTTGGTAGGAAATTCAAAC -3'
(R):5'- GTCCTTGTGAGCTGGAAAGAAAC -3'

Sequencing Primer
(F):5'- TTGGTAGGAAATTCAAACATGAAAAC -3'
(R):5'- TAAAGCTGGCAGTCAGGAGTCTC -3'
Posted On2016-07-06