Incidental Mutation 'R5183:Lrmp'
ID397665
Institutional Source Beutler Lab
Gene Symbol Lrmp
Ensembl Gene ENSMUSG00000030263
Gene Namelymphoid-restricted membrane protein
SynonymsD6Int8, D6Int7, D6Int5, D6Int4, D6Int3, Jaw1
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145115653-145174934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145138220 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 37 (E37G)
Ref Sequence ENSEMBL: ENSMUSP00000032396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000135984] [ENSMUST00000152571]
Predicted Effect probably benign
Transcript: ENSMUST00000032396
AA Change: E37G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263
AA Change: E37G

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135984
AA Change: S51G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149244
Predicted Effect probably benign
Transcript: ENSMUST00000152571
AA Change: E37G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120166
Gene: ENSMUSG00000030263
AA Change: E37G

DomainStartEndE-ValueType
Pfam:MRVI1 9 198 2.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204561
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Lrmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Lrmp APN 6 145167994 missense probably damaging 1.00
IGL01066:Lrmp APN 6 145160955 missense probably damaging 1.00
IGL01877:Lrmp APN 6 145147799 missense probably damaging 0.99
IGL02154:Lrmp APN 6 145138241 missense possibly damaging 0.92
IGL02727:Lrmp APN 6 145174618 missense possibly damaging 0.78
FR4976:Lrmp UTSW 6 145173785 unclassified probably benign
R0238:Lrmp UTSW 6 145171978 unclassified probably benign
R0239:Lrmp UTSW 6 145171978 unclassified probably benign
R0454:Lrmp UTSW 6 145167984 missense possibly damaging 0.73
R0485:Lrmp UTSW 6 145165212 missense probably damaging 1.00
R0487:Lrmp UTSW 6 145165260 missense probably benign 0.02
R0554:Lrmp UTSW 6 145165287 missense probably benign 0.01
R0634:Lrmp UTSW 6 145174628 missense probably damaging 0.98
R1440:Lrmp UTSW 6 145174511 missense possibly damaging 0.77
R1574:Lrmp UTSW 6 145158630 splice site probably benign
R1697:Lrmp UTSW 6 145137615 splice site probably benign
R1968:Lrmp UTSW 6 145169773 missense probably damaging 0.98
R3735:Lrmp UTSW 6 145160870 splice site probably benign
R3736:Lrmp UTSW 6 145160870 splice site probably benign
R4643:Lrmp UTSW 6 145168060 missense probably benign 0.17
R4812:Lrmp UTSW 6 145148011 missense probably damaging 1.00
R4916:Lrmp UTSW 6 145165301 missense probably damaging 1.00
R5845:Lrmp UTSW 6 145171666 missense probably benign 0.00
R6701:Lrmp UTSW 6 145144976 nonsense probably null
R6735:Lrmp UTSW 6 145160893 missense probably damaging 1.00
R7083:Lrmp UTSW 6 145169783 missense probably damaging 1.00
R7317:Lrmp UTSW 6 145158698 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTTCTCTCTGGAGGAAATAGGAAC -3'
(R):5'- TCTGCATGGAAGAGAAAGCC -3'

Sequencing Primer
(F):5'- CTCTGGAGGAAATAGGAACTCTCTTC -3'
(R):5'- CTTCCTGGCTTCAAAGTTAGATG -3'
Posted On2016-07-06