Incidental Mutation 'R5183:Trim34b'
ID397670
Institutional Source Beutler Lab
Gene Symbol Trim34b
Ensembl Gene ENSMUSG00000090215
Gene Nametripartite motif-containing 34B
SynonymsTrim34-2, Gm15134
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104329471-104336909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104329911 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 122 (Q122K)
Ref Sequence ENSEMBL: ENSMUSP00000136926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106847] [ENSMUST00000180136]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106847
AA Change: Q122K

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215
AA Change: Q122K

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178316
AA Change: Q122K

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136248
Gene: ENSMUSG00000090215
AA Change: Q122K

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180136
AA Change: Q122K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215
AA Change: Q122K

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Trim34b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Trim34b APN 7 104329652 nonsense probably null
IGL01103:Trim34b APN 7 104329899 missense probably damaging 1.00
IGL02252:Trim34b APN 7 104329932 missense probably damaging 0.98
IGL03241:Trim34b APN 7 104334613 intron probably benign
R0032:Trim34b UTSW 7 104336577 missense possibly damaging 0.61
R0381:Trim34b UTSW 7 104329855 missense probably damaging 1.00
R2403:Trim34b UTSW 7 104329669 missense probably benign
R2520:Trim34b UTSW 7 104331239 missense probably damaging 1.00
R2857:Trim34b UTSW 7 104336232 missense probably benign 0.00
R2859:Trim34b UTSW 7 104336232 missense probably benign 0.00
R3077:Trim34b UTSW 7 104331301 missense possibly damaging 0.89
R4094:Trim34b UTSW 7 104334588 missense probably benign
R4449:Trim34b UTSW 7 104335728 missense probably benign 0.00
R5700:Trim34b UTSW 7 104336411 missense probably damaging 1.00
R5759:Trim34b UTSW 7 104331433 missense possibly damaging 0.46
R6236:Trim34b UTSW 7 104336318 missense probably damaging 0.99
R6364:Trim34b UTSW 7 104336526 missense probably damaging 0.99
R7034:Trim34b UTSW 7 104329536 start gained probably benign
R7036:Trim34b UTSW 7 104329536 start gained probably benign
R7237:Trim34b UTSW 7 104329587 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GAAAAGCAGCTGTCCTGTGTG -3'
(R):5'- AGGCCAACCCTTTACATAAATGG -3'

Sequencing Primer
(F):5'- GATTCTCGTTGGAAAATCTACAGGC -3'
(R):5'- GAACCCAGTGGTAATGTG -3'
Posted On2016-07-06