Incidental Mutation 'R5183:Coq7'
ID397672
Institutional Source Beutler Lab
Gene Symbol Coq7
Ensembl Gene ENSMUSG00000030652
Gene Namedemethyl-Q 7
Synonymsclk-1
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5183 (G1)
Quality Score191
Status Validated
Chromosome7
Chromosomal Location118509659-118533356 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 118528267 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032887] [ENSMUST00000098090] [ENSMUST00000209146]
Predicted Effect probably benign
Transcript: ENSMUST00000032887
SMART Domains Protein: ENSMUSP00000032887
Gene: ENSMUSG00000030652

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 217 3.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098090
SMART Domains Protein: ENSMUSP00000095695
Gene: ENSMUSG00000030652

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 210 5.9e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207046
Predicted Effect probably benign
Transcript: ENSMUST00000209146
Meta Mutation Damage Score 0.0472 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for null mutations in this gene are embryonic lethal during mid-gestation with aborted neurogenesis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Coq7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Coq7 APN 7 118525304 missense probably damaging 0.98
R0309:Coq7 UTSW 7 118529717 missense possibly damaging 0.92
R0628:Coq7 UTSW 7 118529644 missense probably damaging 1.00
R1459:Coq7 UTSW 7 118510037 missense unknown
R1535:Coq7 UTSW 7 118529674 missense possibly damaging 0.48
R1612:Coq7 UTSW 7 118509911 missense unknown
R2519:Coq7 UTSW 7 118510148 missense unknown
R4095:Coq7 UTSW 7 118527478 critical splice acceptor site probably null
R4516:Coq7 UTSW 7 118509907 missense unknown
R4972:Coq7 UTSW 7 118510117 missense unknown
R5579:Coq7 UTSW 7 118517335 missense unknown
R5619:Coq7 UTSW 7 118527486 splice site probably benign
R5789:Coq7 UTSW 7 118529706 missense possibly damaging 0.50
R6530:Coq7 UTSW 7 118525335 missense probably benign 0.01
R6911:Coq7 UTSW 7 118510162 missense unknown
R7212:Coq7 UTSW 7 118510048 missense unknown
R7248:Coq7 UTSW 7 118529674 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACGATCCTAGCTTCCTTCTGTGAG -3'
(R):5'- TACCTCTTGTGTGCTCAGCG -3'

Sequencing Primer
(F):5'- AGCTTCCTTCTGTGAGTTATTATACC -3'
(R):5'- AGCCGTGTCCCTGTGATG -3'
Posted On2016-07-06