Incidental Mutation 'R5183:Dnase2a'
ID397677
Institutional Source Beutler Lab
Gene Symbol Dnase2a
Ensembl Gene ENSMUSG00000003812
Gene Namedeoxyribonuclease II alpha
Synonyms
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84908560-84922915 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 84909578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000067060] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
Predicted Effect silent
Transcript: ENSMUST00000003910
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067060
SMART Domains Protein: ENSMUSP00000064366
Gene: ENSMUSG00000054191

DomainStartEndE-ValueType
Pfam:EKLF_TAD1 40 66 9e-23 PFAM
Pfam:EKLF_TAD2 78 103 4.9e-16 PFAM
low complexity region 153 180 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 293 317 2.2e-2 SMART
ZnF_C2H2 323 347 7.49e-5 SMART
ZnF_C2H2 353 375 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109741
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000109744
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect probably benign
Transcript: ENSMUST00000134569
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect unknown
Transcript: ENSMUST00000145292
AA Change: L109P
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812
AA Change: L109P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155942
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2*L (low activity) and DNASE2*H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutations of this gene result in perinatal death, anemia, and impaired definitive erythropoiesis in the fetal liver. Homozygotes for one null mutation display diaphragm abnormalities and asphyxiation, as well as a specific defect in the phagocytic phase of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Dnase2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0396:Dnase2a UTSW 8 84909763 splice site probably benign
R1845:Dnase2a UTSW 8 84909322 missense probably benign 0.19
R1870:Dnase2a UTSW 8 84908763 start gained probably benign
R1939:Dnase2a UTSW 8 84910895 missense possibly damaging 0.83
R2113:Dnase2a UTSW 8 84910871 missense probably damaging 0.99
R2442:Dnase2a UTSW 8 84908993 missense probably damaging 1.00
R4815:Dnase2a UTSW 8 84909877 missense probably benign 0.12
R4913:Dnase2a UTSW 8 84908848 missense probably damaging 1.00
R4922:Dnase2a UTSW 8 84908996 unclassified probably null
R6239:Dnase2a UTSW 8 84908879 splice site probably null
R6951:Dnase2a UTSW 8 84909625 missense possibly damaging 0.93
R7215:Dnase2a UTSW 8 84909770 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACTAACCTTTGGCCTGATGAAG -3'
(R):5'- TGAGCGAAGAAGCCTTCCAG -3'

Sequencing Primer
(F):5'- ATGAAGGGTGGGGATTTGCC -3'
(R):5'- TAGCTGCTTGCCTAGAAGAC -3'
Posted On2016-07-06