Incidental Mutation 'R5183:Man2b1'
ID397678
Institutional Source Beutler Lab
Gene Symbol Man2b1
Ensembl Gene ENSMUSG00000005142
Gene Namemannosidase 2, alpha B1
Synonymslysosomal alpha-mannosidase
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85083270-85098282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85095784 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 804 (S804R)
Ref Sequence ENSEMBL: ENSMUSP00000034121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121]
Predicted Effect probably damaging
Transcript: ENSMUST00000034121
AA Change: S804R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: S804R

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Man2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Man2b1 APN 8 85084638 splice site probably null
IGL00671:Man2b1 APN 8 85093938 missense probably damaging 0.98
IGL01538:Man2b1 APN 8 85097430 missense probably benign 0.00
dateline UTSW 8 85084737 missense probably damaging 1.00
meridian UTSW 8 85096752 missense probably damaging 1.00
R0018:Man2b1 UTSW 8 85097489 missense probably damaging 1.00
R0302:Man2b1 UTSW 8 85093016 missense probably damaging 1.00
R0574:Man2b1 UTSW 8 85096776 missense probably benign
R0727:Man2b1 UTSW 8 85091526 missense probably damaging 1.00
R0837:Man2b1 UTSW 8 85096829 missense possibly damaging 0.92
R1087:Man2b1 UTSW 8 85095171 missense probably damaging 1.00
R1471:Man2b1 UTSW 8 85086845 missense probably damaging 0.99
R1745:Man2b1 UTSW 8 85093934 missense probably damaging 1.00
R1903:Man2b1 UTSW 8 85086822 missense probably damaging 1.00
R2026:Man2b1 UTSW 8 85095335 missense probably damaging 0.99
R2071:Man2b1 UTSW 8 85085384 missense possibly damaging 0.90
R2120:Man2b1 UTSW 8 85093024 splice site probably benign
R3897:Man2b1 UTSW 8 85096948 splice site probably benign
R3971:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R3972:Man2b1 UTSW 8 85085391 missense probably damaging 0.98
R4096:Man2b1 UTSW 8 85084737 missense probably damaging 1.00
R4497:Man2b1 UTSW 8 85090936 missense probably benign 0.22
R5191:Man2b1 UTSW 8 85084459 missense probably damaging 1.00
R5644:Man2b1 UTSW 8 85094210 missense possibly damaging 0.61
R6027:Man2b1 UTSW 8 85096752 missense probably damaging 1.00
R6291:Man2b1 UTSW 8 85097046 missense probably benign 0.44
R6341:Man2b1 UTSW 8 85095399 missense probably damaging 1.00
R6467:Man2b1 UTSW 8 85097447 missense possibly damaging 0.91
R6622:Man2b1 UTSW 8 85084479 missense probably damaging 1.00
R6624:Man2b1 UTSW 8 85096853 missense probably benign 0.01
R6631:Man2b1 UTSW 8 85086811 unclassified probably null
R6828:Man2b1 UTSW 8 85086919 missense possibly damaging 0.88
R6983:Man2b1 UTSW 8 85091071 splice site probably null
R7159:Man2b1 UTSW 8 85087280 missense probably benign 0.09
R7267:Man2b1 UTSW 8 85087175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAATCAGACTGAGCCGG -3'
(R):5'- TGCAGGCCCTTAATCCCAAC -3'

Sequencing Primer
(F):5'- CCGGTGGCTGGAAATTACTATCC -3'
(R):5'- CCAACCCAAGAAAGGCAGGG -3'
Posted On2016-07-06