Incidental Mutation 'R5183:Dock6'
ID397680
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.521) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21841603 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 305 (V305I)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000058777] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034728
AA Change: V305I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: V305I

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

DomainStartEndE-ValueType
low complexity region 171 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213775
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: V305I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGAATGCACTAGCTCATC -3'
(R):5'- AAGAAGGTAGGTGCCCTTTC -3'

Sequencing Primer
(F):5'- GAGACCCAACTGTTCCGGTTTG -3'
(R):5'- AAGAAGGTAGGTGCCCTTTCTTCTC -3'
Posted On2016-07-06