Incidental Mutation 'R5183:Celsr3'
ID397683
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 042762-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108837560 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2013 (D2013G)
Ref Sequence ENSEMBL: ENSMUSP00000024238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: D2013G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: D2013G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192235
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193726
Predicted Effect probably damaging
Transcript: ENSMUST00000213524
AA Change: D2015G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
Diminishment UTSW 9 108842708 intron probably benign
little_d UTSW 9 108827692 missense probably damaging 0.98
nogal UTSW 9 108835838 missense probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108832308 missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108845733 missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
R7061:Celsr3 UTSW 9 108847594 nonsense probably null
R7122:Celsr3 UTSW 9 108828567 missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108838004 missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108842951 missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108845762 missense probably benign
R7213:Celsr3 UTSW 9 108849040 missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108829144 missense probably damaging 1.00
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAACCAGGGATCATGCCGG -3'
(R):5'- CAGATTAAGAGGTTAGGGCCC -3'

Sequencing Primer
(F):5'- TCATGCCGGCACCTCCAAG -3'
(R):5'- TTAGGGCCCAAGTCAGGTG -3'
Posted On2016-07-06