Incidental Mutation 'R5183:Tle6'
ID397690
Institutional Source Beutler Lab
Gene Symbol Tle6
Ensembl Gene ENSMUSG00000034758
Gene Nametransducin-like enhancer of split 6
Synonyms1810057E06Rik, Grg6
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81590904-81601073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81592801 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 431 (N431I)
Ref Sequence ENSEMBL: ENSMUSP00000117287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000127546] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000146358] [ENSMUST00000146916] [ENSMUST00000151858]
Predicted Effect probably damaging
Transcript: ENSMUST00000072020
AA Change: N441I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758
AA Change: N441I

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000131411
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135008
Predicted Effect probably benign
Transcript: ENSMUST00000135211
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141913
Predicted Effect probably damaging
Transcript: ENSMUST00000142948
AA Change: N431I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758
AA Change: N431I

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect probably benign
Transcript: ENSMUST00000146358
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect probably benign
Transcript: ENSMUST00000151858
SMART Domains Protein: ENSMUSP00000119945
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Groucho/ transducin-like Enhancer of split family of transcriptional co-repressors. The encoded protein is a component of the mammalian subcortical maternal complex, which is required for preimplantation development. In mouse, knock out of this gene results in cleavage-stage embryonic arrest resulting from defective cytoplasmic F-actin meshwork formation and asymmetric cell division. In human, an allelic variant in this gene is associated with preimplantation embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Tle6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tle6 APN 10 81594458 missense probably damaging 1.00
IGL02151:Tle6 APN 10 81598640 missense probably benign 0.01
IGL02724:Tle6 APN 10 81600064 nonsense probably null
R0420:Tle6 UTSW 10 81595311 unclassified probably benign
R0423:Tle6 UTSW 10 81598623 missense possibly damaging 0.95
R0589:Tle6 UTSW 10 81595419 unclassified probably benign
R0605:Tle6 UTSW 10 81594346 missense probably damaging 0.99
R1554:Tle6 UTSW 10 81595385 missense probably benign 0.05
R1860:Tle6 UTSW 10 81594329 missense probably damaging 1.00
R1863:Tle6 UTSW 10 81591921 missense possibly damaging 0.91
R1952:Tle6 UTSW 10 81595485 missense possibly damaging 0.82
R2139:Tle6 UTSW 10 81594034 missense probably damaging 0.99
R2337:Tle6 UTSW 10 81592656 unclassified probably null
R2849:Tle6 UTSW 10 81594401 missense probably damaging 1.00
R3158:Tle6 UTSW 10 81595204 splice site probably null
R3777:Tle6 UTSW 10 81596153 missense probably benign 0.23
R3778:Tle6 UTSW 10 81596153 missense probably benign 0.23
R4085:Tle6 UTSW 10 81594515 unclassified probably null
R5058:Tle6 UTSW 10 81594238 missense possibly damaging 0.93
R5058:Tle6 UTSW 10 81595957 missense probably damaging 1.00
R6225:Tle6 UTSW 10 81592766 missense probably damaging 1.00
R6331:Tle6 UTSW 10 81595239 missense probably benign 0.00
R6514:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6515:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6517:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R7145:Tle6 UTSW 10 81600076 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGGTATTTTAAAGACCCCTGTGACTTC -3'
(R):5'- GGATGATGTCACTGTTGCCTTC -3'

Sequencing Primer
(F):5'- CAAAAATTCCTTGAGCTGACCTGGG -3'
(R):5'- CTTGCCAAAGGTGTTAAGAGTACCTC -3'
Posted On2016-07-06