Incidental Mutation 'R5183:Gps2'
ID397695
Institutional Source Beutler Lab
Gene Symbol Gps2
Ensembl Gene ENSMUSG00000023170
Gene NameG protein pathway suppressor 2
SynonymsAMF-1
MMRRC Submission 042762-MU
Accession Numbers

Ncbi RefSeq: NM_019726.3; MGI:1891751

Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69913888-69916591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69915197 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 126 (T126A)
Ref Sequence ENSEMBL: ENSMUSP00000112062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043419] [ENSMUST00000057884] [ENSMUST00000061837] [ENSMUST00000070996] [ENSMUST00000071026] [ENSMUST00000072581] [ENSMUST00000108607] [ENSMUST00000108608] [ENSMUST00000108609] [ENSMUST00000108610] [ENSMUST00000108611] [ENSMUST00000108612] [ENSMUST00000108613] [ENSMUST00000108617] [ENSMUST00000116358] [ENSMUST00000133203] [ENSMUST00000134581] [ENSMUST00000152589] [ENSMUST00000153652] [ENSMUST00000164359] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000043419
SMART Domains Protein: ENSMUSP00000047008
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
eIF-5a 83 150 2.43e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057884
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054072
Gene: ENSMUSG00000023170
AA Change: T126A

DomainStartEndE-ValueType
Pfam:G_path_suppress 5 294 6.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070996
SMART Domains Protein: ENSMUSP00000067077
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071026
SMART Domains Protein: ENSMUSP00000068651
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072581
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072389
Gene: ENSMUSG00000023170
AA Change: T126A

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108607
SMART Domains Protein: ENSMUSP00000104247
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108608
SMART Domains Protein: ENSMUSP00000104248
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108609
SMART Domains Protein: ENSMUSP00000104249
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108610
SMART Domains Protein: ENSMUSP00000104250
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108611
SMART Domains Protein: ENSMUSP00000104251
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108612
SMART Domains Protein: ENSMUSP00000104252
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108613
SMART Domains Protein: ENSMUSP00000104253
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108617
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116358
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112062
Gene: ENSMUSG00000023170
AA Change: T126A

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124596
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143861
Predicted Effect probably benign
Transcript: ENSMUST00000152589
SMART Domains Protein: ENSMUSP00000123402
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 2e-39 SMART
Pfam:eIF-5a 83 149 6.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153652
SMART Domains Protein: ENSMUSP00000137459
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
Pfam:eIF-5a 5 72 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164359
SMART Domains Protein: ENSMUSP00000132717
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175761
Predicted Effect probably benign
Transcript: ENSMUST00000177138
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177476
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Gps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R1086:Gps2 UTSW 11 69915224 unclassified probably benign
R1109:Gps2 UTSW 11 69915681 missense possibly damaging 0.94
R1938:Gps2 UTSW 11 69915369 missense probably benign
R1964:Gps2 UTSW 11 69916420 missense probably benign 0.03
R2355:Gps2 UTSW 11 69915381 frame shift probably null
R3773:Gps2 UTSW 11 69916101 missense probably damaging 0.99
R4765:Gps2 UTSW 11 69916361 unclassified probably benign
R4811:Gps2 UTSW 11 69915928 missense probably damaging 0.99
R5119:Gps2 UTSW 11 69914791 missense probably benign 0.00
R5218:Gps2 UTSW 11 69916295 critical splice donor site probably null
R5965:Gps2 UTSW 11 69914794 missense possibly damaging 0.60
R7172:Gps2 UTSW 11 69916436 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCTCAAGAAAGTTTTGCATGAGG -3'
(R):5'- TCACCGTAAGCACTTGTGGTC -3'

Sequencing Primer
(F):5'- TTTTGCATGAGGAAGAAAAACGG -3'
(R):5'- AGCACTTGTGGTCCAAACATCTG -3'
Posted On2016-07-06