Incidental Mutation 'R5183:Gm884'
ID397699
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103543121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 898 (Y898C)
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: Y3074C
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: Y3074C

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167262
AA Change: Y898C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239
AA Change: Y898C

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Secisbp2 T C 13: 51,665,424 S347P probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTTCTCGATCTCTGCAAG -3'
(R):5'- CAGTTCCATGGATGAAAACATAGACC -3'

Sequencing Primer
(F):5'- TCGATCTCTGCAAGACTGTC -3'
(R):5'- ACTGCCATATTTCTCAGAGGG -3'
Posted On2016-07-06