Incidental Mutation 'R5183:Secisbp2'
ID397705
Institutional Source Beutler Lab
Gene Symbol Secisbp2
Ensembl Gene ENSMUSG00000035139
Gene NameSECIS binding protein 2
SynonymsSBP2, 2210413N07Rik, 2810012K13Rik
MMRRC Submission 042762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5183 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location51651697-51684044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51665424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 347 (S347P)
Ref Sequence ENSEMBL: ENSMUSP00000105671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040117] [ENSMUST00000110044]
Predicted Effect probably benign
Transcript: ENSMUST00000040117
AA Change: S347P

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045740
Gene: ENSMUSG00000035139
AA Change: S347P

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 662 764 4.4e-23 PFAM
low complexity region 793 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110044
AA Change: S347P

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105671
Gene: ENSMUSG00000035139
AA Change: S347P

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154202
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: The incorporation of selenocysteine into a protein requires the concerted action of an mRNA element called a sec insertion sequence (SECIS), a selenocysteine-specific translation elongation factor and a SECIS binding protein. With these elements in place, a UGA codon can be decoded as selenocysteine. The gene described in this record encodes a nuclear protein that functions as a SECIS binding protein. Mutations in a similar gene in human have been associated with a reduction in activity of a specific thyroxine deiodinase, a selenocysteine-containing enzyme, and abnormal thyroid hormone metabolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality while heterozygotes exhibit reduced serum selenium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,305 D8E probably damaging Het
Abca3 T G 17: 24,374,453 S275A probably benign Het
Adk A G 14: 21,240,531 N155S probably damaging Het
Aqp11 T C 7: 97,737,756 T78A probably benign Het
Arhgef40 T C 14: 52,004,099 V1455A probably damaging Het
Asxl3 C G 18: 22,525,299 A2122G possibly damaging Het
Cdan1 T A 2: 120,729,580 I368F probably damaging Het
Cdc42bpg A G 19: 6,321,805 probably benign Het
Celsr3 A G 9: 108,837,560 D2013G probably damaging Het
Cep152 A G 2: 125,566,638 V1332A probably damaging Het
Cftr T C 6: 18,299,833 S1172P probably damaging Het
Commd2 A T 3: 57,646,814 D155E probably benign Het
Coq7 T A 7: 118,528,267 probably benign Het
Dnase2a T C 8: 84,909,578 probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Dock6 C T 9: 21,841,603 V305I probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Fasn T C 11: 120,808,882 Q2288R probably benign Het
Fat3 T A 9: 15,960,313 N3594I probably damaging Het
Galnt10 T C 11: 57,769,588 M284T probably damaging Het
Gatm A T 2: 122,595,503 F422L probably benign Het
Glrp1 A T 1: 88,509,852 I12N unknown Het
Gm5455 T A 13: 110,305,428 noncoding transcript Het
Gm6768 A C 12: 119,261,288 noncoding transcript Het
Gm884 T C 11: 103,543,121 Y898C probably damaging Het
Gpam C T 19: 55,083,227 E361K probably damaging Het
Gps2 A G 11: 69,915,197 T126A probably benign Het
Grn C A 11: 102,430,554 probably benign Het
Gsg1 T A 6: 135,241,370 Q176L probably damaging Het
Htra1 C T 7: 130,983,716 A412V possibly damaging Het
Icosl C T 10: 78,069,485 probably benign Het
Iqgap1 T C 7: 80,723,065 T1509A probably damaging Het
Itgad T C 7: 128,198,223 probably null Het
Kdm5a C A 6: 120,430,016 probably benign Het
Kidins220 T C 12: 25,051,126 L1017S probably benign Het
Lrmp A G 6: 145,138,220 E37G probably benign Het
Man2b1 T A 8: 85,095,784 S804R probably damaging Het
Miip A T 4: 147,863,069 F211L probably damaging Het
Moxd1 T G 10: 24,279,547 probably null Het
Moxd1 T G 10: 24,287,136 Y499D probably damaging Het
Mrpl45 T C 11: 97,316,751 I24T probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mthfr T A 4: 148,051,360 probably null Het
Muc5b T A 7: 141,850,810 D827E unknown Het
Myo1g G C 11: 6,508,243 L866V probably damaging Het
Myo3a A T 2: 22,578,158 M475L probably benign Het
Ncoa2 A C 1: 13,174,366 L703V probably damaging Het
Nme6 T A 9: 109,841,489 Y69* probably null Het
Nwd1 T A 8: 72,671,086 M651K probably benign Het
Olfr726 A C 14: 50,084,546 I45S probably damaging Het
Orc2 A T 1: 58,474,818 S298R possibly damaging Het
Oscp1 A T 4: 126,087,729 E328V probably damaging Het
Pan2 T C 10: 128,317,969 V1003A probably damaging Het
Pik3r4 T C 9: 105,682,308 V1200A possibly damaging Het
Prl T C 13: 27,057,596 probably benign Het
Ptprk T C 10: 28,475,236 V575A probably benign Het
Rflna A T 5: 125,011,405 S139C probably damaging Het
Robo1 T C 16: 72,742,150 F27S probably benign Het
Shmt1 A G 11: 60,797,482 probably benign Het
Slc27a3 A G 3: 90,389,170 probably null Het
Slc6a5 T C 7: 49,936,209 V425A probably damaging Het
Slc8a3 A G 12: 81,314,491 V518A possibly damaging Het
Slco1a4 A T 6: 141,839,631 Y78N probably damaging Het
Stt3b A T 9: 115,266,143 H273Q probably damaging Het
Tle6 T A 10: 81,592,801 N431I probably damaging Het
Trim34b C A 7: 104,329,911 Q122K possibly damaging Het
Trio C A 15: 27,902,600 R258S probably benign Het
Ttc7 A T 17: 87,292,878 D23V probably damaging Het
Ttn A T 2: 76,980,181 M1K probably null Het
Ufsp2 T C 8: 45,994,089 V391A probably benign Het
Vps13c T C 9: 67,908,052 L990S probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp618 G A 4: 63,099,282 M234I probably benign Het
Other mutations in Secisbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Secisbp2 APN 13 51676455 critical splice donor site probably null
IGL01316:Secisbp2 APN 13 51654516 missense probably benign 0.06
IGL02576:Secisbp2 APN 13 51670858 missense possibly damaging 0.80
IGL02630:Secisbp2 APN 13 51678906 missense possibly damaging 0.63
IGL02645:Secisbp2 APN 13 51682460 missense probably damaging 1.00
IGL03107:Secisbp2 APN 13 51652757 critical splice donor site probably null
R0208:Secisbp2 UTSW 13 51679845 missense probably benign 0.26
R0453:Secisbp2 UTSW 13 51683325 missense possibly damaging 0.91
R1220:Secisbp2 UTSW 13 51656905 missense probably damaging 1.00
R1278:Secisbp2 UTSW 13 51654510 missense probably damaging 1.00
R1439:Secisbp2 UTSW 13 51679723 splice site probably benign
R1514:Secisbp2 UTSW 13 51682095 missense possibly damaging 0.83
R1568:Secisbp2 UTSW 13 51673107 missense possibly damaging 0.73
R1724:Secisbp2 UTSW 13 51670846 missense probably benign
R2851:Secisbp2 UTSW 13 51654635 splice site probably null
R2967:Secisbp2 UTSW 13 51670879 missense probably benign 0.00
R3156:Secisbp2 UTSW 13 51662675 missense probably benign 0.06
R4393:Secisbp2 UTSW 13 51654466 missense probably damaging 1.00
R4719:Secisbp2 UTSW 13 51652732 missense possibly damaging 0.96
R4953:Secisbp2 UTSW 13 51682027 missense probably damaging 1.00
R5432:Secisbp2 UTSW 13 51673966 small deletion probably benign
R5696:Secisbp2 UTSW 13 51679821 missense probably damaging 1.00
R6007:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R6066:Secisbp2 UTSW 13 51677222 missense probably benign 0.00
R6076:Secisbp2 UTSW 13 51679777 missense probably damaging 0.98
R6164:Secisbp2 UTSW 13 51679860 missense probably damaging 1.00
R6346:Secisbp2 UTSW 13 51679887 missense probably damaging 0.99
R6367:Secisbp2 UTSW 13 51682141 missense probably damaging 1.00
R6790:Secisbp2 UTSW 13 51670903 missense probably benign 0.09
R6888:Secisbp2 UTSW 13 51679941 missense probably benign 0.16
R7095:Secisbp2 UTSW 13 51677254 missense probably benign 0.01
R7104:Secisbp2 UTSW 13 51656907 nonsense probably null
R7261:Secisbp2 UTSW 13 51682462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACTCTGGCTTACTGTTG -3'
(R):5'- CCATGACGTTCAATCATCTTATTGC -3'

Sequencing Primer
(F):5'- GAACTCTGGCTTACTGTTGAAATTG -3'
(R):5'- GACAAGGATTCACTATGTGGCCC -3'
Posted On2016-07-06