Mutagenetix > Incidental Mutation

Incidental Mutation 'R5183:Trio'

397710

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

042762-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5183 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730737-28025934 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27902686 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 258 (R258S)

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226775] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000090247
AA Change: R317S

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: R317S

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226775

Predicted Effect

probably benign
Transcript: ENSMUST00000227337
AA Change: R258S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,887,171 (GRCm39)	D8E	probably damaging	Het
Abca3	T	G	17: 24,593,427 (GRCm39)	S275A	probably benign	Het
Adk	A	G	14: 21,290,599 (GRCm39)	N155S	probably damaging	Het
Aqp11	T	C	7: 97,386,963 (GRCm39)	T78A	probably benign	Het
Arhgef40	T	C	14: 52,241,556 (GRCm39)	V1455A	probably damaging	Het
Asxl3	C	G	18: 22,658,356 (GRCm39)	A2122G	possibly damaging	Het
Cdan1	T	A	2: 120,560,061 (GRCm39)	I368F	probably damaging	Het
Cdc42bpg	A	G	19: 6,371,835 (GRCm39)		probably benign	Het
Celsr3	A	G	9: 108,714,759 (GRCm39)	D2013G	probably damaging	Het
Cep152	A	G	2: 125,408,558 (GRCm39)	V1332A	probably damaging	Het
Cftr	T	C	6: 18,299,832 (GRCm39)	S1172P	probably damaging	Het
Commd2	A	T	3: 57,554,235 (GRCm39)	D155E	probably benign	Het
Coq7	T	A	7: 118,127,490 (GRCm39)		probably benign	Het
Dnase2a	T	C	8: 85,636,207 (GRCm39)		probably benign	Het
Dnhd1	G	A	7: 105,352,416 (GRCm39)	R2523Q	probably damaging	Het
Dock6	C	T	9: 21,752,899 (GRCm39)	V305I	probably benign	Het
Ehmt1	G	T	2: 24,767,509 (GRCm39)	P135T	probably damaging	Het
Fasn	T	C	11: 120,699,708 (GRCm39)	Q2288R	probably benign	Het
Fat3	T	A	9: 15,871,609 (GRCm39)	N3594I	probably damaging	Het
Galnt10	T	C	11: 57,660,414 (GRCm39)	M284T	probably damaging	Het
Gatm	A	T	2: 122,425,984 (GRCm39)	F422L	probably benign	Het
Glrp1	A	T	1: 88,437,574 (GRCm39)	I12N	unknown	Het
Gm5455	T	A	13: 110,441,962 (GRCm39)		noncoding transcript	Het
Gpam	C	T	19: 55,071,659 (GRCm39)	E361K	probably damaging	Het
Gps2	A	G	11: 69,806,023 (GRCm39)	T126A	probably benign	Het
Grn	C	A	11: 102,321,380 (GRCm39)		probably benign	Het
Gsg1	T	A	6: 135,218,368 (GRCm39)	Q176L	probably damaging	Het
Htra1	C	T	7: 130,585,446 (GRCm39)	A412V	possibly damaging	Het
Icosl	C	T	10: 77,905,319 (GRCm39)		probably benign	Het
Iqgap1	T	C	7: 80,372,813 (GRCm39)	T1509A	probably damaging	Het
Irag2	A	G	6: 145,083,946 (GRCm39)	E37G	probably benign	Het
Itgad	T	C	7: 127,797,395 (GRCm39)		probably null	Het
Kdm5a	C	A	6: 120,406,977 (GRCm39)		probably benign	Het
Kidins220	T	C	12: 25,101,125 (GRCm39)	L1017S	probably benign	Het
Lrrc37	T	C	11: 103,433,947 (GRCm39)	Y898C	probably damaging	Het
Man2b1	T	A	8: 85,822,413 (GRCm39)	S804R	probably damaging	Het
Miip	A	T	4: 147,947,526 (GRCm39)	F211L	probably damaging	Het
Moxd1	T	G	10: 24,155,445 (GRCm39)		probably null	Het
Moxd1	T	G	10: 24,163,034 (GRCm39)	Y499D	probably damaging	Het
Mrpl45	T	C	11: 97,207,577 (GRCm39)	I24T	probably benign	Het
Msh2	C	A	17: 88,030,841 (GRCm39)	A906E	probably benign	Het
Mthfr	T	A	4: 148,135,817 (GRCm39)		probably null	Het
Muc5b	T	A	7: 141,404,547 (GRCm39)	D827E	unknown	Het
Myo1g	G	C	11: 6,458,243 (GRCm39)	L866V	probably damaging	Het
Myo3a	A	T	2: 22,468,170 (GRCm39)	M475L	probably benign	Het
Ncoa2	A	C	1: 13,244,590 (GRCm39)	L703V	probably damaging	Het
Ncoa4-ps	A	C	12: 119,225,023 (GRCm39)		noncoding transcript	Het
Nme6	T	A	9: 109,670,557 (GRCm39)	Y69*	probably null	Het
Nwd1	T	A	8: 73,397,714 (GRCm39)	M651K	probably benign	Het
Or4k15c	A	C	14: 50,322,003 (GRCm39)	I45S	probably damaging	Het
Orc2	A	T	1: 58,513,977 (GRCm39)	S298R	possibly damaging	Het
Oscp1	A	T	4: 125,981,522 (GRCm39)	E328V	probably damaging	Het
Pan2	T	C	10: 128,153,838 (GRCm39)	V1003A	probably damaging	Het
Pik3r4	T	C	9: 105,559,507 (GRCm39)	V1200A	possibly damaging	Het
Prl	T	C	13: 27,241,579 (GRCm39)		probably benign	Het
Ptprk	T	C	10: 28,351,232 (GRCm39)	V575A	probably benign	Het
Rflna	A	T	5: 125,088,469 (GRCm39)	S139C	probably damaging	Het
Robo1	T	C	16: 72,539,038 (GRCm39)	F27S	probably benign	Het
Secisbp2	T	C	13: 51,819,460 (GRCm39)	S347P	probably benign	Het
Shmt1	A	G	11: 60,688,308 (GRCm39)		probably benign	Het
Slc27a3	A	G	3: 90,296,477 (GRCm39)		probably null	Het
Slc6a5	T	C	7: 49,585,957 (GRCm39)	V425A	probably damaging	Het
Slc8a3	A	G	12: 81,361,265 (GRCm39)	V518A	possibly damaging	Het
Slco1a4	A	T	6: 141,785,357 (GRCm39)	Y78N	probably damaging	Het
Stt3b	A	T	9: 115,095,211 (GRCm39)	H273Q	probably damaging	Het
Tle6	T	A	10: 81,428,635 (GRCm39)	N431I	probably damaging	Het
Trim34b	C	A	7: 103,979,118 (GRCm39)	Q122K	possibly damaging	Het
Ttc7	A	T	17: 87,600,306 (GRCm39)	D23V	probably damaging	Het
Ttn	A	T	2: 76,810,525 (GRCm39)	M1K	probably null	Het
Ufsp2	T	C	8: 46,447,126 (GRCm39)	V391A	probably benign	Het
Vps13c	T	C	9: 67,815,334 (GRCm39)	L990S	probably damaging	Het
Zfp108	G	T	7: 23,960,163 (GRCm39)	K251N	probably benign	Het
Zfp618	G	A	4: 63,017,519 (GRCm39)	M234I	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27,912,829 (GRCm39)	splice site	probably benign
IGL01011:Trio	APN	15	27,736,575 (GRCm39)	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27,773,093 (GRCm39)	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27,818,253 (GRCm39)	splice site	probably benign
IGL01147:Trio	APN	15	27,881,406 (GRCm39)	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27,749,867 (GRCm39)	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27,905,409 (GRCm39)	missense	probably benign	0.42
IGL01352:Trio	APN	15	27,901,315 (GRCm39)	missense	probably benign	0.01
IGL01366:Trio	APN	15	27,732,954 (GRCm39)	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27,838,861 (GRCm39)	splice site	probably benign
IGL01454:Trio	APN	15	27,833,071 (GRCm39)	missense	probably benign	0.32
IGL01695:Trio	APN	15	27,773,087 (GRCm39)	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27,764,112 (GRCm39)	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27,846,896 (GRCm39)	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27,741,119 (GRCm39)	missense	probably benign	0.12
IGL01991:Trio	APN	15	27,871,360 (GRCm39)	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27,744,244 (GRCm39)	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27,744,139 (GRCm39)	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27,902,647 (GRCm39)	missense	probably benign	0.24
IGL02304:Trio	APN	15	27,735,522 (GRCm39)	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27,847,476 (GRCm39)	nonsense	probably null
IGL02508:Trio	APN	15	27,818,190 (GRCm39)	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27,845,016 (GRCm39)	splice site	probably benign
IGL02617:Trio	APN	15	27,841,935 (GRCm39)	splice site	probably benign
IGL02675:Trio	APN	15	27,768,125 (GRCm39)	unclassified	probably benign
IGL02817:Trio	APN	15	27,902,967 (GRCm39)	missense	probably benign	0.01
IGL02993:Trio	APN	15	27,830,325 (GRCm39)	splice site	probably benign
IGL03007:Trio	APN	15	27,902,828 (GRCm39)	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27,832,097 (GRCm39)	splice site	probably benign
IGL03225:Trio	APN	15	27,902,781 (GRCm39)	missense	probably benign	0.30
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0302:Trio	UTSW	15	27,902,603 (GRCm39)	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27,767,993 (GRCm39)	missense	probably benign	0.00
R0506:Trio	UTSW	15	27,855,049 (GRCm39)	missense	probably benign	0.12
R0564:Trio	UTSW	15	27,805,908 (GRCm39)	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27,831,485 (GRCm39)	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27,732,980 (GRCm39)	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27,741,336 (GRCm39)	critical splice donor site	probably null
R1018:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27,898,000 (GRCm39)	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27,753,890 (GRCm39)	splice site	probably benign
R1488:Trio	UTSW	15	27,741,053 (GRCm39)	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27,732,726 (GRCm39)	missense	probably benign	0.28
R1531:Trio	UTSW	15	27,833,071 (GRCm39)	missense	probably benign	0.32
R1640:Trio	UTSW	15	27,833,130 (GRCm39)	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27,758,433 (GRCm39)	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27,744,232 (GRCm39)	splice site	probably null
R1780:Trio	UTSW	15	27,744,124 (GRCm39)	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27,841,842 (GRCm39)	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27,748,426 (GRCm39)	missense	probably benign
R1817:Trio	UTSW	15	27,742,581 (GRCm39)	nonsense	probably null
R1853:Trio	UTSW	15	27,756,622 (GRCm39)	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27,742,466 (GRCm39)	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27,833,142 (GRCm39)	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27,732,977 (GRCm39)	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27,774,013 (GRCm39)	missense	probably damaging	1.00
R2025:Trio	UTSW	15	27,744,223 (GRCm39)	missense	probably damaging	0.99
R2050:Trio	UTSW	15	27,852,031 (GRCm39)	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27,824,061 (GRCm39)	splice site	probably null
R2913:Trio	UTSW	15	27,854,998 (GRCm39)	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27,805,862 (GRCm39)	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27,833,156 (GRCm39)	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27,744,187 (GRCm39)	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27,749,883 (GRCm39)	nonsense	probably null
R4370:Trio	UTSW	15	27,748,423 (GRCm39)	nonsense	probably null
R4547:Trio	UTSW	15	27,819,068 (GRCm39)	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27,773,084 (GRCm39)	small deletion	probably benign
R4620:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27,752,875 (GRCm39)	splice site	probably null
R4764:Trio	UTSW	15	27,732,624 (GRCm39)	nonsense	probably null
R4775:Trio	UTSW	15	27,881,428 (GRCm39)	nonsense	probably null
R4942:Trio	UTSW	15	27,752,811 (GRCm39)	missense	probably benign	0.21
R5004:Trio	UTSW	15	27,755,264 (GRCm39)	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27,754,115 (GRCm39)	missense	possibly damaging	0.74
R5186:Trio	UTSW	15	27,898,077 (GRCm39)	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27,748,372 (GRCm39)	missense	probably benign	0.02
R5344:Trio	UTSW	15	27,735,618 (GRCm39)	missense	probably benign	0.12
R5407:Trio	UTSW	15	27,844,892 (GRCm39)	splice site	probably null
R5442:Trio	UTSW	15	27,856,280 (GRCm39)	missense	probably benign	0.04
R5617:Trio	UTSW	15	27,902,834 (GRCm39)	missense	probably benign
R5778:Trio	UTSW	15	27,856,250 (GRCm39)	missense	probably benign	0.33
R5986:Trio	UTSW	15	27,852,019 (GRCm39)	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27,891,545 (GRCm39)	missense	probably benign	0.10
R6011:Trio	UTSW	15	27,735,631 (GRCm39)	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27,891,465 (GRCm39)	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27,818,157 (GRCm39)	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27,744,038 (GRCm39)	critical splice donor site	probably null
R6387:Trio	UTSW	15	27,752,825 (GRCm39)	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27,902,997 (GRCm39)	missense	probably benign	0.02
R6478:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R6528:Trio	UTSW	15	27,805,956 (GRCm39)	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27,855,082 (GRCm39)	missense	probably benign	0.00
R6825:Trio	UTSW	15	27,889,394 (GRCm39)	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27,919,374 (GRCm39)	unclassified	probably benign
R6945:Trio	UTSW	15	27,824,176 (GRCm39)	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27,805,740 (GRCm39)	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27,832,137 (GRCm39)	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27,749,885 (GRCm39)	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27,898,086 (GRCm39)	missense	unknown
R7094:Trio	UTSW	15	27,891,534 (GRCm39)	missense	unknown
R7123:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27,871,273 (GRCm39)	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27,828,437 (GRCm39)	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27,871,375 (GRCm39)	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27,732,962 (GRCm39)	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R7451:Trio	UTSW	15	27,747,999 (GRCm39)	missense	probably benign	0.07
R7558:Trio	UTSW	15	27,831,480 (GRCm39)	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27,855,025 (GRCm39)	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27,749,912 (GRCm39)	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27,736,531 (GRCm39)	critical splice donor site	probably null
R7609:Trio	UTSW	15	27,912,728 (GRCm39)	missense	unknown
R7767:Trio	UTSW	15	27,889,504 (GRCm39)	missense	unknown
R7784:Trio	UTSW	15	27,764,080 (GRCm39)	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R7833:Trio	UTSW	15	27,774,172 (GRCm39)	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27,805,770 (GRCm39)	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27,852,010 (GRCm39)	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27,773,021 (GRCm39)	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R8050:Trio	UTSW	15	27,891,540 (GRCm39)	missense	unknown
R8217:Trio	UTSW	15	27,819,055 (GRCm39)	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27,902,996 (GRCm39)	missense	unknown
R8283:Trio	UTSW	15	27,756,628 (GRCm39)	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27,855,108 (GRCm39)	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27,881,412 (GRCm39)	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27,774,038 (GRCm39)	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27,901,286 (GRCm39)	missense	probably benign	0.25
R8682:Trio	UTSW	15	27,905,278 (GRCm39)	missense	unknown
R8688:Trio	UTSW	15	27,748,324 (GRCm39)	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27,732,632 (GRCm39)	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27,919,323 (GRCm39)	missense	unknown
R8713:Trio	UTSW	15	27,744,037 (GRCm39)	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27,851,923 (GRCm39)	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27,905,311 (GRCm39)	missense	unknown
R8816:Trio	UTSW	15	27,741,357 (GRCm39)	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27,741,150 (GRCm39)	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27,732,773 (GRCm39)	missense	probably benign	0.23
R9051:Trio	UTSW	15	27,732,770 (GRCm39)	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27,852,097 (GRCm39)	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27,774,022 (GRCm39)	nonsense	probably null
R9079:Trio	UTSW	15	27,733,023 (GRCm39)	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27,749,922 (GRCm39)	nonsense	probably null
R9494:Trio	UTSW	15	27,846,843 (GRCm39)	missense	probably benign	0.00
R9680:Trio	UTSW	15	27,744,158 (GRCm39)	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27,847,495 (GRCm39)	missense	probably benign	0.00
R9726:Trio	UTSW	15	27,912,752 (GRCm39)	missense	unknown
X0024:Trio	UTSW	15	27,765,812 (GRCm39)	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27,771,473 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATGAGTCTTGGCTGTGAGAC -3'
(R):5'- AGTTGCCTCAGGACCTAGAG -3'

Sequencing Primer
(F):5'- TTGGCTGTGAGACCCACTAAC -3'
(R):5'- CTCGGAACATGATCGACGAGC -3'

Posted On

2016-07-06