Incidental Mutation 'R5184:Prr12'
ID397751
Institutional Source Beutler Lab
Gene Symbol Prr12
Ensembl Gene ENSMUSG00000046574
Gene Nameproline rich 12
Synonyms
MMRRC Submission 042763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R5184 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45027563-45052881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45046377 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1222 (V1222L)
Ref Sequence ENSEMBL: ENSMUSP00000054702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057293]
Predicted Effect unknown
Transcript: ENSMUST00000057293
AA Change: V1222L
SMART Domains Protein: ENSMUSP00000054702
Gene: ENSMUSG00000046574
AA Change: V1222L

DomainStartEndE-ValueType
low complexity region 135 150 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
low complexity region 330 376 N/A INTRINSIC
low complexity region 388 413 N/A INTRINSIC
low complexity region 418 444 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
low complexity region 469 487 N/A INTRINSIC
low complexity region 535 559 N/A INTRINSIC
low complexity region 598 616 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
low complexity region 858 871 N/A INTRINSIC
low complexity region 883 896 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 986 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
low complexity region 1059 1070 N/A INTRINSIC
AT_hook 1161 1173 5.74e1 SMART
AT_hook 1193 1205 8.09e0 SMART
low complexity region 1252 1264 N/A INTRINSIC
low complexity region 1308 1328 N/A INTRINSIC
low complexity region 1417 1535 N/A INTRINSIC
low complexity region 1684 1748 N/A INTRINSIC
Pfam:DUF4211 1817 1950 6.5e-21 PFAM
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that contains two A-T hook DNA binding domains. A chromosomal translocation and gene fusion between this gene and zinc finger, MIZ-type containing 1 (Gene ID: 57178) may underlie intellectual disability and neuropsychiatric problems in a human patient. Enriched expression of this gene in embryonic mouse brain suggests that this gene may play a role in nervous system development. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1a T A 3: 95,895,739 probably null Het
Arid3a A G 10: 79,950,769 E452G possibly damaging Het
Barhl2 A G 5: 106,457,640 S68P unknown Het
BC030499 T C 11: 78,292,747 F194L probably benign Het
Carf T C 1: 60,108,174 S17P probably damaging Het
Ccdc90b A G 7: 92,574,811 D145G probably damaging Het
Cyp7a1 A T 4: 6,271,207 N316K probably benign Het
Daam2 A G 17: 49,494,391 I106T possibly damaging Het
Dmtf1 A G 5: 9,126,641 V437A probably benign Het
E2f2 A T 4: 136,184,440 Y254F possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Ern2 T C 7: 122,179,959 T221A probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fermt1 A G 2: 132,941,963 V42A possibly damaging Het
Fgf3 A G 7: 144,842,810 D187G probably damaging Het
Flnb T A 14: 7,901,945 V936E probably damaging Het
Gm5415 A T 1: 32,545,648 C394S probably damaging Het
Herc2 T C 7: 56,122,351 Y1093H probably damaging Het
Invs A G 4: 48,283,242 probably benign Het
Katnb1 T A 8: 95,097,980 I534N possibly damaging Het
Kcnq5 A T 1: 21,402,487 D826E probably damaging Het
Klra9 A T 6: 130,188,712 N113K probably benign Het
Knl1 A G 2: 119,069,176 K453E probably damaging Het
Lgi4 C T 7: 31,070,757 probably benign Het
Lpin3 A G 2: 160,897,138 S289G probably benign Het
Mapre1 T A 2: 153,758,067 V137E possibly damaging Het
Mark4 A G 7: 19,447,243 F144L possibly damaging Het
Mogat2 G T 7: 99,223,635 A114E possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nell2 A G 15: 95,527,809 L19P possibly damaging Het
Nfia A T 4: 97,783,348 K98N probably damaging Het
Nutm1 T A 2: 112,249,000 T857S possibly damaging Het
Olfr146 T A 9: 39,018,702 I280F probably damaging Het
Olfr298 TG T 7: 86,489,291 probably null Het
Olfr68 T C 7: 103,777,404 K314E probably benign Het
Pde10a T C 17: 8,977,155 L706P probably damaging Het
Penk A G 4: 4,134,296 L117P probably damaging Het
Pgap1 A G 1: 54,481,856 S876P probably damaging Het
Pmfbp1 T C 8: 109,527,767 I478T possibly damaging Het
Pole G A 5: 110,294,934 E318K possibly damaging Het
Prune2 T C 19: 17,216,357 S3070P possibly damaging Het
Rnf19a A G 15: 36,244,196 C573R probably benign Het
Rp1l1 T C 14: 64,030,180 S1072P probably damaging Het
Sh3pxd2a T C 19: 47,273,411 N315S possibly damaging Het
Snph T C 2: 151,594,544 I86V probably damaging Het
Sox6 A G 7: 115,777,228 Y90H probably damaging Het
Tbc1d13 T A 2: 30,142,311 C145S probably benign Het
Tcp11l1 T C 2: 104,699,944 E65G probably damaging Het
Thrb G T 14: 18,011,181 E186* probably null Het
Tmem101 A G 11: 102,156,233 Y38H possibly damaging Het
Tusc5 T A 11: 76,680,308 L50Q probably damaging Het
Urb1 A T 16: 90,783,274 probably null Het
Usp10 G A 8: 119,956,681 V764I possibly damaging Het
Usp25 A G 16: 77,109,227 E857G probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr35 T C 12: 9,018,142 L775P probably damaging Het
Xpnpep1 T C 19: 53,013,414 T134A probably benign Het
Zbtb10 T C 3: 9,264,671 V363A probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Prr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Prr12 APN 7 45047458 missense unknown
IGL01603:Prr12 APN 7 45043485 missense probably damaging 0.96
IGL01941:Prr12 APN 7 45048659 unclassified probably benign
IGL02043:Prr12 APN 7 45050005 unclassified probably benign
IGL02170:Prr12 APN 7 45046188 missense unknown
IGL02494:Prr12 APN 7 45028846 missense unknown
IGL02947:Prr12 APN 7 45048556 missense unknown
R0128:Prr12 UTSW 7 45050039 unclassified probably benign
R0255:Prr12 UTSW 7 45049991 unclassified probably benign
R0556:Prr12 UTSW 7 45030669 missense unknown
R1168:Prr12 UTSW 7 45029047 missense unknown
R1266:Prr12 UTSW 7 45050253 unclassified probably benign
R1374:Prr12 UTSW 7 45046218 missense unknown
R1531:Prr12 UTSW 7 45028530 missense unknown
R1537:Prr12 UTSW 7 45028942 missense unknown
R1572:Prr12 UTSW 7 45028800 missense unknown
R1617:Prr12 UTSW 7 45049594 unclassified probably benign
R1647:Prr12 UTSW 7 45034192 missense probably benign 0.20
R1694:Prr12 UTSW 7 45028579 missense unknown
R1732:Prr12 UTSW 7 45048356 missense unknown
R1819:Prr12 UTSW 7 45048697 unclassified probably benign
R2114:Prr12 UTSW 7 45046082 missense unknown
R2210:Prr12 UTSW 7 45049351 unclassified probably benign
R2846:Prr12 UTSW 7 45046012 missense unknown
R2902:Prr12 UTSW 7 45047612 missense unknown
R2985:Prr12 UTSW 7 45046012 missense unknown
R4094:Prr12 UTSW 7 45047947 missense unknown
R4498:Prr12 UTSW 7 45045914 missense unknown
R4523:Prr12 UTSW 7 45048523 missense unknown
R4763:Prr12 UTSW 7 45047695 missense unknown
R4775:Prr12 UTSW 7 45051325 unclassified probably benign
R4995:Prr12 UTSW 7 45051229 unclassified probably benign
R5007:Prr12 UTSW 7 45049801 unclassified probably benign
R5045:Prr12 UTSW 7 45049894 unclassified probably benign
R5897:Prr12 UTSW 7 45043384 missense probably damaging 1.00
R6847:Prr12 UTSW 7 45045740 missense unknown
R6912:Prr12 UTSW 7 45048845 unclassified probably benign
R7147:Prr12 UTSW 7 45033850 missense unknown
X0066:Prr12 UTSW 7 45047003 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCTTGCCTGACTTGAGAAAG -3'
(R):5'- CCTGAGTACTGGGGAAGATCTG -3'

Sequencing Primer
(F):5'- GTCAAGGAAGGACGCCATGAAC -3'
(R):5'- GGCCTCCTGTCTCAAGTAGTCAG -3'
Posted On2016-07-06