Incidental Mutation 'R5185:Nfatc2'
ID397799
Institutional Source Beutler Lab
Gene Symbol Nfatc2
Ensembl Gene ENSMUSG00000027544
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
SynonymsNFAT1-D, NFATp, NFAT1
MMRRC Submission 042764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5185 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168476410-168601657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168570707 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 132 (F132L)
Ref Sequence ENSEMBL: ENSMUSP00000130875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029057] [ENSMUST00000074618] [ENSMUST00000109184] [ENSMUST00000137451] [ENSMUST00000171689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029057
AA Change: F353L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029057
Gene: ENSMUSG00000027544
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 2.6e-24 PFAM
Blast:IPT 579 618 8e-19 BLAST
SCOP:d1imhc1 579 619 3e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000074618
AA Change: F353L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD_DNA_bind 412 572 2.8e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099067
Predicted Effect possibly damaging
Transcript: ENSMUST00000109184
AA Change: F353L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 1.3e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137451
AA Change: F333L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118329
Gene: ENSMUSG00000027544
AA Change: F333L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 216 235 N/A INTRINSIC
low complexity region 247 263 N/A INTRINSIC
Pfam:RHD 392 552 7.9e-25 PFAM
Blast:IPT 559 598 8e-19 BLAST
SCOP:d1imhc1 559 599 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140137
Predicted Effect possibly damaging
Transcript: ENSMUST00000171689
AA Change: F132L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130875
Gene: ENSMUSG00000027544
AA Change: F132L

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
Pfam:RHD 191 351 1.3e-24 PFAM
Blast:IPT 358 397 4e-19 BLAST
SCOP:d1imhc1 358 398 1e-9 SMART
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 T C 11: 94,562,911 Y408C probably damaging Het
Aox4 T C 1: 58,254,318 L943S probably damaging Het
Ap1g1 G A 8: 109,863,326 probably benign Het
Arsb T C 13: 93,794,159 S212P probably damaging Het
Arsi A G 18: 60,916,912 N289S probably damaging Het
Atp6v1h T A 1: 5,095,642 F72I probably damaging Het
Atxn7 T C 14: 14,090,063 I336T probably benign Het
Bak1 G A 17: 27,022,748 P65L possibly damaging Het
Bcl6 A T 16: 23,972,947 M219K possibly damaging Het
Brd3 T C 2: 27,462,448 K157E probably damaging Het
Ccdc171 T G 4: 83,663,655 S674A possibly damaging Het
Cfap43 A G 19: 47,780,394 I737T probably benign Het
Cul9 A T 17: 46,525,832 V1089D possibly damaging Het
Dffa C A 4: 149,117,430 A155E probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Efcab12 T A 6: 115,823,490 M191L probably benign Het
Efl1 T C 7: 82,772,499 L1018P probably damaging Het
Fcho1 A G 8: 71,714,956 probably benign Het
Fndc3b T A 3: 27,457,070 T764S probably benign Het
Gm29125 T C 1: 80,384,231 noncoding transcript Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gm9949 T G 18: 62,180,565 probably benign Het
Golgb1 T C 16: 36,875,141 probably benign Het
Gpd2 T C 2: 57,340,204 Y323H probably damaging Het
Grip1 T G 10: 119,931,259 D96E probably benign Het
Hmcn1 T C 1: 150,656,741 I3132V probably benign Het
Hsd17b1 T C 11: 101,080,198 W327R possibly damaging Het
Htra2 G A 6: 83,054,242 P62L probably benign Het
Kdr A T 5: 75,952,417 probably null Het
Kif14 T A 1: 136,527,469 C1626* probably null Het
Kmt2a A T 9: 44,820,246 probably benign Het
Krt15 T C 11: 100,133,433 T321A probably damaging Het
Lactbl1 A T 4: 136,631,045 H109L probably benign Het
Lilra6 T A 7: 3,914,636 H120L probably benign Het
Lpcat2 G A 8: 92,869,737 S134N probably benign Het
Mpp4 T C 1: 59,125,583 D465G probably benign Het
Naip2 A T 13: 100,189,351 D16E probably damaging Het
Nek5 C T 8: 22,083,381 A520T possibly damaging Het
Nlrp3 C A 11: 59,565,084 T902N probably benign Het
Olfr1097 T C 2: 86,890,602 D191G probably benign Het
Olfr1230 A T 2: 89,296,387 H294Q probably benign Het
Olfr149 A T 9: 39,701,876 W298R probably benign Het
Olfr58 T C 9: 19,783,376 M81T probably damaging Het
Pcdhb16 T C 18: 37,480,089 S701P possibly damaging Het
Phf7 A G 14: 31,248,037 probably null Het
Plpp4 G A 7: 129,316,304 V68M probably damaging Het
Pnma2 A T 14: 66,916,129 M1L possibly damaging Het
Pnmal2 A T 7: 16,945,976 D295V probably damaging Het
Rad21l T C 2: 151,657,462 D270G probably benign Het
Ralgapa2 C A 2: 146,388,486 probably null Het
Rasal3 A T 17: 32,396,790 L334Q probably damaging Het
Rfx4 G T 10: 84,863,250 R240L probably damaging Het
Rnf19b T A 4: 129,083,920 C642* probably null Het
Slc28a2 G A 2: 122,458,194 E594K probably benign Het
Spata31 G T 13: 64,917,526 W15L possibly damaging Het
Spink5 T C 18: 44,015,644 S925P probably damaging Het
Svep1 C T 4: 58,084,534 G1865S probably damaging Het
Tg T C 15: 66,773,474 L791P probably damaging Het
Thbs4 A C 13: 92,775,167 V247G probably damaging Het
Tpcn2 A T 7: 145,255,454 F705Y probably damaging Het
Try10 A T 6: 41,356,549 H76L probably damaging Het
Ttn C T 2: 76,939,221 V2695I probably damaging Het
Tut1 C A 19: 8,955,450 T49N probably benign Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Xdh G A 17: 73,925,011 R235C probably damaging Het
Yipf4 A G 17: 74,492,475 D70G probably null Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Other mutations in Nfatc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Nfatc2 APN 2 168504890 missense probably damaging 1.00
IGL01728:Nfatc2 APN 2 168536242 missense probably damaging 1.00
IGL02303:Nfatc2 APN 2 168506901 nonsense probably null
IGL02887:Nfatc2 APN 2 168504450 missense probably damaging 1.00
IGL03002:Nfatc2 APN 2 168534984 missense probably damaging 1.00
IGL03297:Nfatc2 APN 2 168536218 missense probably damaging 0.99
R0347:Nfatc2 UTSW 2 168536290 missense probably damaging 1.00
R0590:Nfatc2 UTSW 2 168571199 missense probably damaging 0.99
R0631:Nfatc2 UTSW 2 168590115 missense probably benign 0.02
R1019:Nfatc2 UTSW 2 168504879 missense probably damaging 1.00
R1183:Nfatc2 UTSW 2 168590088 missense possibly damaging 0.83
R1420:Nfatc2 UTSW 2 168504665 missense probably benign 0.01
R1977:Nfatc2 UTSW 2 168504459 missense possibly damaging 0.68
R2306:Nfatc2 UTSW 2 168590103 missense probably damaging 1.00
R3034:Nfatc2 UTSW 2 168535020 missense probably damaging 1.00
R3176:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3276:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3964:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R3966:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R4669:Nfatc2 UTSW 2 168571490 missense probably benign
R4864:Nfatc2 UTSW 2 168536392 missense probably damaging 0.96
R4951:Nfatc2 UTSW 2 168571072 missense probably damaging 0.98
R5138:Nfatc2 UTSW 2 168536309 missense probably damaging 1.00
R5145:Nfatc2 UTSW 2 168590067 missense probably benign 0.25
R5444:Nfatc2 UTSW 2 168534890 intron probably benign
R5496:Nfatc2 UTSW 2 168536278 missense probably damaging 1.00
R5728:Nfatc2 UTSW 2 168480249 missense probably benign
R5791:Nfatc2 UTSW 2 168536393 missense probably benign 0.28
R6102:Nfatc2 UTSW 2 168519507 intron probably benign
R6157:Nfatc2 UTSW 2 168519451 intron probably benign
R6187:Nfatc2 UTSW 2 168480238 missense probably benign 0.13
R7116:Nfatc2 UTSW 2 168507349 missense probably benign 0.04
R7218:Nfatc2 UTSW 2 168571264 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAAACCAGCTCTTAGGGC -3'
(R):5'- AGAGGCTTTGGTTGCTCCTC -3'

Sequencing Primer
(F):5'- AGCTCTTAGGGCACACTCG -3'
(R):5'- TGCAGGACGACAGCATCC -3'
Posted On2016-07-06