Incidental Mutation 'R5233:Rorc'
ID398084
Institutional Source Beutler Lab
Gene Symbol Rorc
Ensembl Gene ENSMUSG00000028150
Gene NameRAR-related orphan receptor gamma
SynonymsThor, thymus orphan receptor, RORgamma
MMRRC Submission 042805-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock #R5233 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94372794-94398276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94397325 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 339 (V339D)
Ref Sequence ENSEMBL: ENSMUSP00000143610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000050975] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably benign
Transcript: ENSMUST00000029795
AA Change: V508D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150
AA Change: V508D

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050975
SMART Domains Protein: ENSMUSP00000058050
Gene: ENSMUSG00000044505

DomainStartEndE-ValueType
LRRNT 55 89 1.23e-4 SMART
LRR 88 107 2.76e2 SMART
LRR_TYP 108 131 1.02e-6 SMART
LRR_TYP 132 155 7.26e-3 SMART
LRR 156 179 1.33e1 SMART
LRR_TYP 180 203 5.42e-2 SMART
LRR 204 227 4.45e1 SMART
LRR 228 251 3.27e1 SMART
LRR 300 323 4.83e0 SMART
LRR 324 347 3.07e-1 SMART
LRR 348 371 3.36e1 SMART
LRRCT 383 436 5.24e-5 SMART
IGc2 451 516 3.53e-13 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197040
AA Change: V487D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150
AA Change: V487D

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198829
Predicted Effect probably benign
Transcript: ENSMUST00000200009
AA Change: V339D

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150
AA Change: V339D

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030619P08Rik T A 15: 75,429,952 noncoding transcript Het
Aadat A G 8: 60,526,622 I173V probably benign Het
Acsl6 G A 11: 54,325,606 V200I possibly damaging Het
Alms1 T A 6: 85,656,371 probably null Het
Arhgef17 A T 7: 100,881,369 D1403E possibly damaging Het
Atp10b A G 11: 43,230,560 T1017A probably benign Het
Capg C T 6: 72,555,526 R25C probably damaging Het
Cd22 A G 7: 30,877,534 I116T probably damaging Het
Cep135 AGTCTGCCTTTGG A 5: 76,591,843 probably benign Het
Ciita A T 16: 10,509,401 I277F possibly damaging Het
Col15a1 T C 4: 47,296,112 V943A possibly damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Csn3 C T 5: 87,929,835 P67S probably benign Het
Csrnp3 A G 2: 66,022,340 T359A possibly damaging Het
Cttnbp2nl A G 3: 105,005,041 L509P probably damaging Het
Dclk3 A G 9: 111,468,681 D431G probably benign Het
Dtx3l A T 16: 35,933,238 C333S possibly damaging Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Fam171a1 G C 2: 3,178,353 G72A probably damaging Het
Fbxw17 T C 13: 50,432,354 probably benign Het
Fry A G 5: 150,469,720 D605G possibly damaging Het
Fyn T C 10: 39,529,940 F240S probably benign Het
Gcfc2 T C 6: 81,953,290 L646P probably damaging Het
Gm5087 C T 14: 13,158,788 noncoding transcript Het
Got2 T A 8: 95,875,849 N91I probably benign Het
Hspa4 C T 11: 53,286,975 V103I possibly damaging Het
Itgad A G 7: 128,193,428 probably null Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Mcph1 T C 8: 18,671,238 I694T probably damaging Het
Mmp15 T C 8: 95,371,068 V502A probably benign Het
Mov10l1 T C 15: 88,983,032 V23A probably benign Het
Myo9a T A 9: 59,910,617 N2322K probably damaging Het
Ndst4 A G 3: 125,710,117 Y11C probably damaging Het
Nell1 T C 7: 50,176,314 F199S probably damaging Het
Nup210 C T 6: 91,026,969 V646M probably damaging Het
Nup98 A T 7: 102,195,822 S13R unknown Het
Nxf1 T C 19: 8,763,929 I54T possibly damaging Het
Olfr885 A G 9: 38,062,150 T277A probably damaging Het
Pcdh10 C A 3: 45,384,191 R928S probably damaging Het
Pou3f3 A G 1: 42,698,278 N378S probably benign Het
Rfx6 T A 10: 51,712,091 Y109* probably null Het
Scin T A 12: 40,077,559 I411F probably benign Het
Serpind1 A G 16: 17,336,894 Y195C probably damaging Het
Tas2r117 T C 6: 132,803,622 V241A possibly damaging Het
Tet3 T A 6: 83,386,063 E709V probably damaging Het
Trbc1 T A 6: 41,538,449 probably benign Het
Vmn1r212 C A 13: 22,883,134 G343V unknown Het
Vmn2r42 T A 7: 8,194,838 K261* probably null Het
Xrcc5 T A 1: 72,340,050 L438Q probably damaging Het
Zfp142 T C 1: 74,585,449 N72S probably damaging Het
Zfp292 A T 4: 34,809,755 S1096R probably damaging Het
Other mutations in Rorc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias UTSW 3 94397302 nonsense probably null
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
R0014:Rorc UTSW 3 94377613 splice site probably benign
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7162:Rorc UTSW 3 94377608 splice site probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGTAACAGTGAGATGTGTTTGC -3'
(R):5'- GCTGCTGTTGTCCTACAAGG -3'

Sequencing Primer
(F):5'- TGCTCTGCTAAGCACCGAAG -3'
(R):5'- TGTTGTCCTACAAGGCAAGC -3'
Posted On2016-07-06