Incidental Mutation 'R5191:Lgr6'
ID398093
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 6
SynonymsA530037C04Rik
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134983301-135105276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134994010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 199 (A199T)
Ref Sequence ENSEMBL: ENSMUSP00000122334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828] [ENSMUST00000137968]
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: A476T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: A476T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137968
AA Change: A199T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122334
Gene: ENSMUSG00000042793
AA Change: A199T

DomainStartEndE-ValueType
Blast:LRR 4 26 2e-7 BLAST
LRR 50 73 9.24e1 SMART
LRR 74 96 1.41e0 SMART
LRR 97 119 4.84e1 SMART
LRR_TYP 120 143 4.54e-4 SMART
LRR_TYP 144 167 7.15e-2 SMART
Pfam:7tm_1 301 550 3.6e-9 PFAM
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R2020:Lgr6 UTSW 1 135075275 missense probably damaging 1.00
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTTCCTTCGGGGTCACAAG -3'
(R):5'- CAGGAATCAGGCTTCAAGATTCC -3'

Sequencing Primer
(F):5'- GTCACAAGGATCCCTACTAATACTTC -3'
(R):5'- TTATGGTTGCAAGTCACCACAGC -3'
Posted On2016-07-06