Incidental Mutation 'R5203:Mtmr10'
ID398252
Institutional Source Beutler Lab
Gene Symbol Mtmr10
Ensembl Gene ENSMUSG00000030522
Gene Namemyotubularin related protein 10
Synonyms
MMRRC Submission 042778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R5203 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location64287653-64340806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64318161 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 273 (V273I)
Ref Sequence ENSEMBL: ENSMUSP00000032736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032736] [ENSMUST00000206452]
Predicted Effect probably benign
Transcript: ENSMUST00000032736
AA Change: V273I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032736
Gene: ENSMUSG00000030522
AA Change: V273I

DomainStartEndE-ValueType
Pfam:Myotub-related 176 330 8.6e-12 PFAM
Pfam:Myotub-related 319 508 2.7e-56 PFAM
Pfam:3-PAP 570 701 2.2e-57 PFAM
low complexity region 730 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206452
Predicted Effect probably benign
Transcript: ENSMUST00000206680
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T G 16: 4,835,598 S4A unknown Het
Adgrv1 A T 13: 81,510,905 N2053K possibly damaging Het
Akr1c13 C T 13: 4,197,897 R223* probably null Het
Arhgef11 A G 3: 87,735,357 Y1370C probably damaging Het
Arid1a T C 4: 133,682,003 E1731G unknown Het
Cyp2c54 A T 19: 40,072,474 V75E probably damaging Het
Fa2h A G 8: 111,349,364 M209T probably benign Het
Fam171a1 T C 2: 3,223,545 I311T probably damaging Het
Fat3 C A 9: 16,378,142 L28F possibly damaging Het
Fntb C A 12: 76,837,572 P22Q probably benign Het
Gmeb1 T C 4: 132,232,009 probably null Het
Gpr22 A G 12: 31,709,788 S112P probably damaging Het
Htr7 A G 19: 35,964,392 S464P probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Krt79 A G 15: 101,929,740 S527P unknown Het
Lnpep A T 17: 17,537,063 D858E probably damaging Het
Ly9 C A 1: 171,599,779 V403F probably damaging Het
Mindy4 A G 6: 55,255,661 Q363R probably benign Het
Mup2 T A 4: 60,139,728 E20V probably damaging Het
Myo16 A G 8: 10,360,995 N151S probably damaging Het
Nod2 A C 8: 88,664,451 D462A probably damaging Het
Nt5c2 A G 19: 46,889,808 Y497H probably damaging Het
Olfr102 A T 17: 37,314,201 L61Q probably damaging Het
Olfr1294 A C 2: 111,537,636 Y218D probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhac1 A T 18: 37,091,190 D352V probably damaging Het
Psap A G 10: 60,294,975 D195G probably damaging Het
Scyl1 G A 19: 5,771,367 probably benign Het
Sh3bgr A G 16: 96,224,520 probably benign Het
Slc2a12 G T 10: 22,645,314 probably null Het
Slc2a12 G C 10: 22,692,218 V515L probably benign Het
Ttc17 T C 2: 94,378,716 Y131C probably damaging Het
Ttc27 A G 17: 74,777,654 D419G probably damaging Het
Ubxn8 T C 8: 33,633,611 E100G probably damaging Het
Zpbp T C 11: 11,408,451 E272G probably damaging Het
Other mutations in Mtmr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Mtmr10 APN 7 64337712 missense probably benign
IGL02082:Mtmr10 APN 7 64333490 splice site probably benign
IGL02234:Mtmr10 APN 7 64299602 missense probably benign 0.04
IGL02448:Mtmr10 APN 7 64308150 missense probably damaging 1.00
IGL02515:Mtmr10 APN 7 64337511 missense probably damaging 1.00
Curlyq UTSW 7 64333439 missense probably damaging 1.00
K7371:Mtmr10 UTSW 7 64314210 missense probably benign 0.18
PIT4472001:Mtmr10 UTSW 7 64333358 missense probably benign 0.23
R0302:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R0619:Mtmr10 UTSW 7 64321213 missense probably benign 0.00
R0787:Mtmr10 UTSW 7 64300615 missense possibly damaging 0.95
R0972:Mtmr10 UTSW 7 64326709 missense probably damaging 1.00
R1482:Mtmr10 UTSW 7 64314249 missense probably damaging 1.00
R1770:Mtmr10 UTSW 7 64336721 missense possibly damaging 0.47
R1826:Mtmr10 UTSW 7 64337466 missense probably benign 0.00
R2174:Mtmr10 UTSW 7 64336764 missense possibly damaging 0.94
R2215:Mtmr10 UTSW 7 64337655 missense probably benign 0.00
R2352:Mtmr10 UTSW 7 64297580 missense possibly damaging 0.71
R2411:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R3702:Mtmr10 UTSW 7 64337899 missense probably damaging 1.00
R3710:Mtmr10 UTSW 7 64326685 missense possibly damaging 0.86
R3802:Mtmr10 UTSW 7 64320628 missense probably benign 0.29
R4190:Mtmr10 UTSW 7 64314186 missense probably benign 0.37
R4484:Mtmr10 UTSW 7 64320631 missense possibly damaging 0.86
R4562:Mtmr10 UTSW 7 64314159 missense possibly damaging 0.92
R5128:Mtmr10 UTSW 7 64333439 missense probably damaging 1.00
R5444:Mtmr10 UTSW 7 64288401 unclassified probably null
R5627:Mtmr10 UTSW 7 64336752 missense probably damaging 1.00
R5786:Mtmr10 UTSW 7 64337710 missense probably damaging 1.00
R7078:Mtmr10 UTSW 7 64320627 missense possibly damaging 0.65
R7236:Mtmr10 UTSW 7 64314184 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CACTCCTCATAAATCTAGGTTTGAC -3'
(R):5'- TGTTGCAGCGCGTCTTTGA -3'

Sequencing Primer
(F):5'- GGTTACTGCGCTGTGATTAAACACC -3'
(R):5'- CAGCGCGTCTTTGATGAGG -3'
Posted On2016-07-06