Incidental Mutation 'R5203:Slc2a12'
ID398263
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission 042778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5203 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 22692218 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 515 (V515L)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
AA Change: V515L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: V515L

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T G 16: 4,835,598 S4A unknown Het
Adgrv1 A T 13: 81,510,905 N2053K possibly damaging Het
Akr1c13 C T 13: 4,197,897 R223* probably null Het
Arhgef11 A G 3: 87,735,357 Y1370C probably damaging Het
Arid1a T C 4: 133,682,003 E1731G unknown Het
Cyp2c54 A T 19: 40,072,474 V75E probably damaging Het
Fa2h A G 8: 111,349,364 M209T probably benign Het
Fam171a1 T C 2: 3,223,545 I311T probably damaging Het
Fat3 C A 9: 16,378,142 L28F possibly damaging Het
Fntb C A 12: 76,837,572 P22Q probably benign Het
Gmeb1 T C 4: 132,232,009 probably null Het
Gpr22 A G 12: 31,709,788 S112P probably damaging Het
Htr7 A G 19: 35,964,392 S464P probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Krt79 A G 15: 101,929,740 S527P unknown Het
Lnpep A T 17: 17,537,063 D858E probably damaging Het
Ly9 C A 1: 171,599,779 V403F probably damaging Het
Mindy4 A G 6: 55,255,661 Q363R probably benign Het
Mtmr10 G A 7: 64,318,161 V273I probably benign Het
Mup2 T A 4: 60,139,728 E20V probably damaging Het
Myo16 A G 8: 10,360,995 N151S probably damaging Het
Nod2 A C 8: 88,664,451 D462A probably damaging Het
Nt5c2 A G 19: 46,889,808 Y497H probably damaging Het
Olfr102 A T 17: 37,314,201 L61Q probably damaging Het
Olfr1294 A C 2: 111,537,636 Y218D probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhac1 A T 18: 37,091,190 D352V probably damaging Het
Psap A G 10: 60,294,975 D195G probably damaging Het
Scyl1 G A 19: 5,771,367 probably benign Het
Sh3bgr A G 16: 96,224,520 probably benign Het
Ttc17 T C 2: 94,378,716 Y131C probably damaging Het
Ttc27 A G 17: 74,777,654 D419G probably damaging Het
Ubxn8 T C 8: 33,633,611 E100G probably damaging Het
Zpbp T C 11: 11,408,451 E272G probably damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCCAGGCAGGACTTG -3'
(R):5'- CCAGATATCCATGCTGAAATTCCATG -3'

Sequencing Primer
(F):5'- CAGGACTTGGAGAGAGACCATG -3'
(R):5'- GCATTAAGATTGAAGGCTGCTTAG -3'
Posted On2016-07-06