Incidental Mutation 'R0454:Trpa1'
ID39827
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0454 (G1)
Quality Score158
Status Not validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 14885748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect probably null
Transcript: ENSMUST00000041447
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7412:Trpa1 UTSW 1 14884198 missense probably benign 0.43
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTTCAACTAGGCAGGGATCTTACCA -3'
(R):5'- GCTCACTTTGCATTGTTTGACCATACA -3'

Sequencing Primer
(F):5'- GGCAGGGATCTTACCAAAAATTATG -3'
(R):5'- CTAAAAGAGATGGGTGTTTCCATGAC -3'
Posted On2013-05-23