Incidental Mutation 'R5235:Ido2'
ID398304
Institutional Source Beutler Lab
Gene Symbol Ido2
Ensembl Gene ENSMUSG00000031549
Gene Nameindoleamine 2,3-dioxygenase 2
SynonymsIndol1, C230043N17Rik, Ido2
MMRRC Submission 042807-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5235 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24531892-24576333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24547186 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 168 (I168N)
Ref Sequence ENSEMBL: ENSMUSP00000113979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121992]
Predicted Effect probably damaging
Transcript: ENSMUST00000121992
AA Change: I168N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113979
Gene: ENSMUSG00000031549
AA Change: I168N

DomainStartEndE-ValueType
Pfam:IDO 15 399 1.4e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140417
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell function and decreased susceptibility to type IV hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C A 7: 41,624,832 H126Q possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aga A G 8: 53,514,326 H124R probably damaging Het
Ank1 G A 8: 23,082,196 G49R probably damaging Het
Aox1 G T 1: 58,057,555 V270L possibly damaging Het
Arfrp1 T C 2: 181,359,505 H145R probably benign Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg3 A G 16: 45,159,157 T20A probably benign Het
C3ar1 A G 6: 122,850,922 L112P probably damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Csmd3 T C 15: 47,629,278 T3156A probably benign Het
Dag1 T C 9: 108,207,698 Y748C probably damaging Het
Dek A T 13: 47,086,479 probably null Het
Fras1 G A 5: 96,600,750 V695M probably benign Het
Gm4858 A G 3: 93,074,086 D137G probably damaging Het
Gpx7 A G 4: 108,400,992 S135P probably damaging Het
Lca5 A T 9: 83,423,054 L233* probably null Het
Liph A C 16: 21,984,035 L95V probably damaging Het
Mast1 A T 8: 84,913,439 L1113Q probably damaging Het
Nlrx1 C T 9: 44,263,750 G243D probably damaging Het
Olfr1168 T A 2: 88,185,568 D230E probably benign Het
Olfr1187-ps1 G A 2: 88,540,425 noncoding transcript Het
Otoa T C 7: 121,156,470 L1033P probably damaging Het
Ovol3 A T 7: 30,233,474 Y179N possibly damaging Het
Papss2 A G 19: 32,639,219 N215S probably benign Het
Pcdhga8 T C 18: 37,727,435 Y515H probably damaging Het
Phlda1 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC 10: 111,507,391 probably benign Het
Scn2a A T 2: 65,752,011 N1568Y probably damaging Het
Sec16b A T 1: 157,534,764 I251F probably benign Het
Slc29a4 T A 5: 142,718,768 I355N probably damaging Het
Snx29 G T 16: 11,413,246 C39F possibly damaging Het
Spata16 A G 3: 26,667,632 M101V probably benign Het
Stat2 T C 10: 128,291,032 probably null Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Tpm3 A G 3: 90,086,495 E97G probably damaging Het
Ugt8a A C 3: 125,867,480 H454Q probably damaging Het
Vmn2r27 T A 6: 124,192,054 I706L probably damaging Het
Wdfy3 T C 5: 101,847,106 I3256V probably null Het
Other mutations in Ido2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Ido2 UTSW 8 24558143 splice site probably null
R1103:Ido2 UTSW 8 24576223 missense probably benign 0.08
R1601:Ido2 UTSW 8 24576189 missense possibly damaging 0.57
R1868:Ido2 UTSW 8 24553760 missense possibly damaging 0.90
R2158:Ido2 UTSW 8 24540636 missense probably damaging 1.00
R2266:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2267:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2268:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2484:Ido2 UTSW 8 24533815 missense probably damaging 1.00
R3151:Ido2 UTSW 8 24533760 missense possibly damaging 0.61
R3735:Ido2 UTSW 8 24535193 missense probably damaging 0.98
R3820:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3821:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3822:Ido2 UTSW 8 24533755 missense probably benign 0.00
R4520:Ido2 UTSW 8 24576178 missense probably damaging 0.99
R4824:Ido2 UTSW 8 24533859 missense probably benign 0.12
R4949:Ido2 UTSW 8 24533954 critical splice acceptor site probably null
R5580:Ido2 UTSW 8 24550866 missense possibly damaging 0.67
R5961:Ido2 UTSW 8 24533770 missense probably damaging 1.00
R6433:Ido2 UTSW 8 24533923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAGACGGAGAAGTCGGTTC -3'
(R):5'- TGTGGCAGCAATTCATCCTTGG -3'

Sequencing Primer
(F):5'- GTCGGTTCACTCCAGGCTAAAAG -3'
(R):5'- CTTGGGTTAGAACTCTAGTCAGGCAC -3'
Posted On2016-07-06