Mutagenetix > Incidental Mutation

Incidental Mutation 'R5204:Trpm3'

398388

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

6330504P12Rik, LTRPC3, melastatin 2, B930001P07Rik, MLSN2

MMRRC Submission

042779-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5204 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22116410-22972774 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 22425705 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 20 (L20*)

Ref Sequence

ENSEMBL: ENSMUSP00000042184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

probably null
Transcript: ENSMUST00000037901
AA Change: L20*

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: L20*

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074770

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087576

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099569

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185015

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	A	T	11: 101,297,752 (GRCm39)	L532Q	probably damaging	Het
Abt1	G	A	13: 23,606,838 (GRCm39)	R88C	probably damaging	Het
Aopep	G	A	13: 63,180,904 (GRCm39)	V289I	probably benign	Het
Arhgef7	T	A	8: 11,850,775 (GRCm39)	L129*	probably null	Het
Arid1b	T	C	17: 5,393,316 (GRCm39)	V2282A	probably damaging	Het
Bivm	G	C	1: 44,177,738 (GRCm39)	G346A	probably damaging	Het
Cav1	T	C	6: 17,339,254 (GRCm39)	L102P	probably damaging	Het
Ccdc57	A	G	11: 120,776,888 (GRCm39)	V504A	possibly damaging	Het
Cd7	A	T	11: 120,928,860 (GRCm39)		probably null	Het
Cdh3	T	C	8: 107,270,871 (GRCm39)	V508A	probably benign	Het
Chrd	A	T	16: 20,554,822 (GRCm39)	I413F	probably benign	Het
Clec4b1	T	A	6: 123,048,494 (GRCm39)	*210R	probably null	Het
Clock	A	T	5: 76,391,017 (GRCm39)		probably null	Het
Col4a2	T	A	8: 11,448,651 (GRCm39)		probably null	Het
Gpx7	T	C	4: 108,260,512 (GRCm39)	T95A	probably benign	Het
Hivep3	T	A	4: 119,961,053 (GRCm39)		probably null	Het
Hrc	A	G	7: 44,985,128 (GRCm39)	Y93C	possibly damaging	Het
Igkv4-80	A	C	6: 68,993,649 (GRCm39)	S81A	probably benign	Het
Klhl5	G	T	5: 65,288,781 (GRCm39)	L14F	possibly damaging	Het
Mcm6	A	G	1: 128,261,375 (GRCm39)	L743P	probably benign	Het
Nrxn1	A	T	17: 90,469,792 (GRCm39)	F57Y	probably damaging	Het
Or51af1	C	T	7: 103,141,747 (GRCm39)	V113M	probably damaging	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Pcdh20	G	T	14: 88,706,351 (GRCm39)	D316E	probably damaging	Het
Pcdhb12	T	A	18: 37,569,142 (GRCm39)	V96E	probably damaging	Het
Pi4ka	A	T	16: 17,176,909 (GRCm39)	L346M	possibly damaging	Het
Pkhd1l1	A	C	15: 44,410,437 (GRCm39)	N2648T	possibly damaging	Het
Rufy1	C	T	11: 50,297,261 (GRCm39)	R397Q	probably damaging	Het
Sema5a	G	T	15: 32,686,793 (GRCm39)	M968I	probably benign	Het
Slc33a1	A	G	3: 63,871,167 (GRCm39)	Y149H	probably damaging	Het
Tln2	T	A	9: 67,261,764 (GRCm39)	R658S	probably benign	Het
Tmem30c	T	C	16: 57,090,385 (GRCm39)	N274S	possibly damaging	Het
Tor3a	A	G	1: 156,483,270 (GRCm39)	L384P	probably damaging	Het
Ttn	T	A	2: 76,560,556 (GRCm39)	I20955F	probably damaging	Het
Usp15	A	T	10: 122,949,545 (GRCm39)	S908R	probably benign	Het
Zfp866	A	G	8: 70,218,690 (GRCm39)	L310P	probably damaging	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22,965,023 (GRCm39)	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22,877,523 (GRCm39)	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22,964,435 (GRCm39)	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22,692,610 (GRCm39)	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22,964,491 (GRCm39)	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22,891,838 (GRCm39)	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22,689,083 (GRCm39)	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22,879,433 (GRCm39)	nonsense	probably null
IGL02324:Trpm3	APN	19	22,676,143 (GRCm39)	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22,878,483 (GRCm39)	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22,866,776 (GRCm39)	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22,891,829 (GRCm39)	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22,903,435 (GRCm39)	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22,834,082 (GRCm39)	missense	probably damaging	1.00
bit	UTSW	19	22,965,233 (GRCm39)	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22,903,392 (GRCm39)	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22,875,050 (GRCm39)	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22,692,695 (GRCm39)	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22,964,893 (GRCm39)	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22,964,893 (GRCm39)	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22,891,810 (GRCm39)	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22,891,810 (GRCm39)	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22,965,280 (GRCm39)	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22,692,720 (GRCm39)	splice site	probably null
R0268:Trpm3	UTSW	19	22,874,885 (GRCm39)	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22,964,237 (GRCm39)	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22,965,418 (GRCm39)	missense	probably benign
R0481:Trpm3	UTSW	19	22,878,435 (GRCm39)	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22,676,142 (GRCm39)	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22,964,237 (GRCm39)	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22,965,176 (GRCm39)	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22,965,153 (GRCm39)	missense	probably benign
R0883:Trpm3	UTSW	19	22,956,018 (GRCm39)	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22,965,407 (GRCm39)	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22,891,781 (GRCm39)	splice site	probably benign
R1185:Trpm3	UTSW	19	22,891,781 (GRCm39)	splice site	probably benign
R1513:Trpm3	UTSW	19	22,964,236 (GRCm39)	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22,878,585 (GRCm39)	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22,955,698 (GRCm39)	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22,866,809 (GRCm39)	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22,710,388 (GRCm39)	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22,116,519 (GRCm39)	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22,960,076 (GRCm39)	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22,689,271 (GRCm39)	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22,862,776 (GRCm39)	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22,903,446 (GRCm39)	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22,959,947 (GRCm39)	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22,710,398 (GRCm39)	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22,964,354 (GRCm39)	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22,425,741 (GRCm39)	missense	probably benign
R3774:Trpm3	UTSW	19	22,965,339 (GRCm39)	missense	probably benign	0.03
R3774:Trpm3	UTSW	19	22,955,966 (GRCm39)	missense	possibly damaging	0.66
R3776:Trpm3	UTSW	19	22,955,966 (GRCm39)	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22,964,813 (GRCm39)	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22,878,524 (GRCm39)	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22,964,928 (GRCm39)	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22,956,002 (GRCm39)	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22,964,656 (GRCm39)	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22,875,061 (GRCm39)	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22,875,061 (GRCm39)	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22,955,694 (GRCm39)	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22,965,381 (GRCm39)	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22,965,381 (GRCm39)	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22,965,233 (GRCm39)	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22,879,506 (GRCm39)	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22,955,988 (GRCm39)	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22,964,752 (GRCm39)	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22,965,145 (GRCm39)	missense	probably benign
R4713:Trpm3	UTSW	19	22,866,799 (GRCm39)	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22,692,659 (GRCm39)	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22,689,076 (GRCm39)	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22,676,130 (GRCm39)	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22,862,713 (GRCm39)	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22,744,120 (GRCm39)	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22,896,130 (GRCm39)	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22,882,078 (GRCm39)	missense	probably benign	0.06
R5213:Trpm3	UTSW	19	22,674,818 (GRCm39)	nonsense	probably null
R5358:Trpm3	UTSW	19	22,903,332 (GRCm39)	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22,903,548 (GRCm39)	nonsense	probably null
R5382:Trpm3	UTSW	19	22,862,705 (GRCm39)	splice site	probably null
R5509:Trpm3	UTSW	19	22,964,622 (GRCm39)	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22,955,937 (GRCm39)	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22,965,178 (GRCm39)	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22,887,418 (GRCm39)	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22,878,669 (GRCm39)	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22,903,477 (GRCm39)	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22,965,347 (GRCm39)	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22,955,946 (GRCm39)	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22,903,392 (GRCm39)	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22,956,048 (GRCm39)	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22,879,557 (GRCm39)	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22,955,698 (GRCm39)	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22,955,937 (GRCm39)	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22,875,160 (GRCm39)	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22,903,458 (GRCm39)	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22,896,154 (GRCm39)	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22,882,148 (GRCm39)	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22,896,060 (GRCm39)	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22,692,640 (GRCm39)	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22,964,772 (GRCm39)	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22,676,226 (GRCm39)	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22,887,501 (GRCm39)	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22,896,040 (GRCm39)	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22,965,580 (GRCm39)	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22,955,952 (GRCm39)	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22,887,493 (GRCm39)	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22,744,034 (GRCm39)	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22,903,308 (GRCm39)	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22,896,124 (GRCm39)	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22,955,745 (GRCm39)	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22,896,004 (GRCm39)	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22,425,696 (GRCm39)	missense	probably benign
R9514:Trpm3	UTSW	19	22,960,040 (GRCm39)	missense	probably benign	0.42
R9545:Trpm3	UTSW	19	22,878,458 (GRCm39)	missense	probably benign	0.24
R9712:Trpm3	UTSW	19	22,692,716 (GRCm39)	missense	possibly damaging	0.55
R9721:Trpm3	UTSW	19	22,866,762 (GRCm39)	missense	probably benign	0.00
R9750:Trpm3	UTSW	19	22,903,495 (GRCm39)	missense	probably benign	0.00
Z1176:Trpm3	UTSW	19	22,964,854 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCGGCCACATTTGGTATGC -3'
(R):5'- GCGAAGTTGGGCGTTTCAAC -3'

Sequencing Primer
(F):5'- CCACATTTGGTATGCATGAGCAC -3'
(R):5'- TTGGGCGTTTCAACCTGAAAAG -3'

Posted On

2016-07-06