Incidental Mutation 'R5205:Kcna2'
ID398404
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 2
SynonymsMk-2, Akr6a4, Kca1-2, Kv1.2
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107101146-107115005 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 107097146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000197470]
Predicted Effect probably benign
Transcript: ENSMUST00000038695
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000060946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182414
Predicted Effect probably benign
Transcript: ENSMUST00000197470
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1838:Kcna2 UTSW 3 107104512 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4662:Kcna2 UTSW 3 107105417 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107105498 missense probably benign 0.00
R5472:Kcna2 UTSW 3 107105309 missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107104793 missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107104750 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACTCTACTCAGTGGTTTATCCCC -3'
(R):5'- TTTGAGAGTAGAGTGCTGCCC -3'

Sequencing Primer
(F):5'- TGAGTCTCAGCTAAATCACAGCAGG -3'
(R):5'- CCTACTGACATCAGAAGTCTGTTG -3'
Posted On2016-07-06