Incidental Mutation 'R5205:Ybx1'
ID398413
Institutional Source Beutler Lab
Gene Symbol Ybx1
Ensembl Gene ENSMUSG00000028639
Gene NameY box protein 1
SynonymsdbpB, DNA binding protein B, EF1A, MSY1, Nsep1, YB-1
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119277981-119294604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119279151 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 261 (D261E)
Ref Sequence ENSEMBL: ENSMUSP00000078589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079644] [ENSMUST00000127737]
Predicted Effect probably damaging
Transcript: ENSMUST00000079644
AA Change: D261E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078589
Gene: ENSMUSG00000028639
AA Change: D261E

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 25 48 N/A INTRINSIC
CSP 58 126 8.65e-24 SMART
low complexity region 140 159 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
low complexity region 179 206 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127737
AA Change: D153E

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117225
Gene: ENSMUSG00000028639
AA Change: D153E

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145976
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit embryonic and perinatal lethality and are severely growth retarded. Some mice exhibit craniofacial defects and respiratory failure. MEFs are more sensitive to oxidative stress resulting in premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Ybx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ybx1 APN 4 119282312 missense probably damaging 1.00
IGL02635:Ybx1 APN 4 119279089 missense possibly damaging 0.88
R0136:Ybx1 UTSW 4 119282354 missense possibly damaging 0.57
R0270:Ybx1 UTSW 4 119281591 missense probably benign 0.11
R4911:Ybx1 UTSW 4 119282813 missense probably benign 0.13
R4957:Ybx1 UTSW 4 119278938 utr 3 prime probably benign
R4986:Ybx1 UTSW 4 119282430 missense probably damaging 0.99
R7098:Ybx1 UTSW 4 119282853 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CTTACCCGGATGATGGTAGAGATG -3'
(R):5'- AGTAAGCTTGTCTGAAAGACCAC -3'

Sequencing Primer
(F):5'- AGATGGTAAGCCGGCATTTACTC -3'
(R):5'- CTTGAATAAATGGTTGGTGCACCCAG -3'
Posted On2016-07-06