Incidental Mutation 'R5205:Zfp985'
ID398415
Institutional Source Beutler Lab
Gene Symbol Zfp985
Ensembl Gene ENSMUSG00000065999
Gene Namezinc finger protein 985
SynonymsGm13154
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R5205 (G1)
Quality Score196
Status Validated
Chromosome4
Chromosomal Location147553277-147585198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147582911 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 79 (I79F)
Ref Sequence ENSEMBL: ENSMUSP00000123296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081742] [ENSMUST00000139784] [ENSMUST00000143885]
Predicted Effect probably damaging
Transcript: ENSMUST00000081742
AA Change: I79F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080438
Gene: ENSMUSG00000065999
AA Change: I79F

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
ZnF_C2H2 238 260 8.34e-3 SMART
ZnF_C2H2 266 288 1.47e-3 SMART
ZnF_C2H2 294 316 2.36e-2 SMART
ZnF_C2H2 322 344 8.34e-3 SMART
ZnF_C2H2 350 372 7.67e-2 SMART
ZnF_C2H2 378 400 8.6e-5 SMART
ZnF_C2H2 406 428 8.6e-5 SMART
ZnF_C2H2 434 456 7.9e-4 SMART
ZnF_C2H2 462 484 1.95e-3 SMART
ZnF_C2H2 490 512 2.09e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139784
AA Change: I79F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123296
Gene: ENSMUSG00000065999
AA Change: I79F

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143885
AA Change: I79F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121177
Gene: ENSMUSG00000065999
AA Change: I79F

DomainStartEndE-ValueType
KRAB 13 72 4.36e-15 SMART
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Other mutations in Zfp985
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0098:Zfp985 UTSW 4 147577109 missense probably damaging 0.97
R0324:Zfp985 UTSW 4 147582857 missense probably benign 0.00
R1307:Zfp985 UTSW 4 147583247 missense probably benign
R1594:Zfp985 UTSW 4 147583080 missense probably benign 0.05
R1657:Zfp985 UTSW 4 147584110 missense probably benign 0.01
R1667:Zfp985 UTSW 4 147583950 missense possibly damaging 0.84
R1761:Zfp985 UTSW 4 147584045 missense probably benign 0.00
R1858:Zfp985 UTSW 4 147582858 missense probably benign 0.29
R2509:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2510:Zfp985 UTSW 4 147582986 missense possibly damaging 0.75
R2847:Zfp985 UTSW 4 147583011 nonsense probably null
R2848:Zfp985 UTSW 4 147583011 nonsense probably null
R4245:Zfp985 UTSW 4 147582939 missense probably damaging 0.96
R4260:Zfp985 UTSW 4 147583572 missense probably damaging 1.00
R4434:Zfp985 UTSW 4 147583911 missense probably benign 0.37
R4480:Zfp985 UTSW 4 147584079 missense probably benign 0.07
R4512:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4514:Zfp985 UTSW 4 147583563 missense probably damaging 1.00
R4528:Zfp985 UTSW 4 147582890 missense possibly damaging 0.49
R4836:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R4884:Zfp985 UTSW 4 147583344 missense probably benign 0.04
R5054:Zfp985 UTSW 4 147582981 missense probably damaging 0.98
R5106:Zfp985 UTSW 4 147584155 missense probably damaging 0.97
R5266:Zfp985 UTSW 4 147582832 critical splice acceptor site probably null
R5468:Zfp985 UTSW 4 147583245 missense probably benign
R5533:Zfp985 UTSW 4 147582983 nonsense probably null
R6282:Zfp985 UTSW 4 147583348 missense probably benign 0.00
R6303:Zfp985 UTSW 4 147583775 missense probably benign 0.01
R6609:Zfp985 UTSW 4 147583121 missense probably benign
R6609:Zfp985 UTSW 4 147583667 missense probably damaging 1.00
R6722:Zfp985 UTSW 4 147583071 missense probably benign 0.26
R6858:Zfp985 UTSW 4 147583307 nonsense probably null
R7064:Zfp985 UTSW 4 147583116 missense probably benign 0.20
R7216:Zfp985 UTSW 4 147583456 missense probably damaging 1.00
X0050:Zfp985 UTSW 4 147583271 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTCTCTTGAGAGTACGAATCC -3'
(R):5'- CATGTGGATTCCTTGATTGAGAC -3'

Sequencing Primer
(F):5'- CTTGAGAGTACGAATCCATAAGCTC -3'
(R):5'- GATTCCTTGATTGAGACTAATGGTAG -3'
Posted On2016-07-06