Incidental Mutation 'R5205:Tmem43'
ID398422
Institutional Source Beutler Lab
Gene Symbol Tmem43
Ensembl Gene ENSMUSG00000030095
Gene Nametransmembrane protein 43
Synonyms1200015A22Rik, LUMA
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91473703-91488463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91486781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 346 (I346T)
Ref Sequence ENSEMBL: ENSMUSP00000032183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000032183]
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000032183
AA Change: I346T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095
AA Change: I346T

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:DUF1625 121 373 3.6e-88 PFAM
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TMEM43 family. Defects in this gene are the cause of familial arrhythmogenic right ventricular dysplasia type 5 (ARVD5), also known as arrhythmogenic right ventricular cardiomyopathy type 5 (ARVC5). Arrhythmogenic right ventricular dysplasia is an inherited disorder, often involving both ventricles, and is characterized by ventricular tachycardia, heart failure, sudden cardiac death, and fibrofatty replacement of cardiomyocytes. This gene contains a response element for PPAR gamma (an adipogenic transcription factor), which may explain the fibrofatty replacement of the myocardium, a characteristic pathological finding in ARVC. [provided by RefSeq, Oct 2008]
PHENOTYPE: In a gihg-throughput screen, female homozygous mutant mice exhibited an increased anxiety-like response during open field activity testing when compared with their gender-matched wild-type littermates and the historical mean. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Tmem43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tmem43 APN 6 91477374 missense possibly damaging 0.73
IGL03105:Tmem43 APN 6 91480700 missense probably damaging 1.00
R0415:Tmem43 UTSW 6 91482318 missense probably benign 0.13
R1388:Tmem43 UTSW 6 91478803 splice site probably null
R1581:Tmem43 UTSW 6 91478735 missense probably benign 0.01
R1777:Tmem43 UTSW 6 91477330 nonsense probably null
R1895:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R1946:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R2697:Tmem43 UTSW 6 91479929 missense possibly damaging 0.85
R4778:Tmem43 UTSW 6 91482255 missense probably damaging 1.00
R5366:Tmem43 UTSW 6 91478258 missense probably benign 0.43
R5383:Tmem43 UTSW 6 91473890 missense probably benign 0.00
R5516:Tmem43 UTSW 6 91478210 missense possibly damaging 0.70
R5569:Tmem43 UTSW 6 91477354 missense probably benign 0.01
R5656:Tmem43 UTSW 6 91480708 missense probably benign 0.01
R6490:Tmem43 UTSW 6 91478777 missense probably damaging 0.97
R6490:Tmem43 UTSW 6 91486880 missense possibly damaging 0.91
S24628:Tmem43 UTSW 6 91482318 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CACCCCGTGGTATCTTAGGTATG -3'
(R):5'- TAGATGCCTGATCCAGCTGAG -3'

Sequencing Primer
(F):5'- ATGTGTGTGGCTATGTATGGCTCTAC -3'
(R):5'- AGGGAATCTGGCCTCTCAG -3'
Posted On2016-07-06