Incidental Mutation 'R5205:Lrrc28'
ID398428
Institutional Source Beutler Lab
Gene Symbol Lrrc28
Ensembl Gene ENSMUSG00000030556
Gene Nameleucine rich repeat containing 28
Synonyms2210012C09Rik, 1300004K21Rik, 2310058O11Rik
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5205 (G1)
Quality Score183
Status Validated
Chromosome7
Chromosomal Location67513410-67645268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67531768 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 240 (S240P)
Ref Sequence ENSEMBL: ENSMUSP00000052177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053950] [ENSMUST00000187953] [ENSMUST00000191035]
Predicted Effect probably benign
Transcript: ENSMUST00000053950
AA Change: S240P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052177
Gene: ENSMUSG00000030556
AA Change: S240P

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR_TYP 110 132 6.67e-2 SMART
LRR 133 156 6.4e0 SMART
LRR 179 202 1.64e-1 SMART
low complexity region 304 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185818
Predicted Effect probably benign
Transcript: ENSMUST00000187953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190770
Predicted Effect probably benign
Transcript: ENSMUST00000191035
SMART Domains Protein: ENSMUSP00000140382
Gene: ENSMUSG00000030556

DomainStartEndE-ValueType
LRR 40 63 1.33e-1 SMART
LRR 64 86 3.24e0 SMART
LRR 87 109 1.06e1 SMART
LRR 110 132 8.09e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191062
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Lrrc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Lrrc28 APN 7 67628294 critical splice donor site probably null
IGL01583:Lrrc28 APN 7 67545475 splice site probably null
IGL02033:Lrrc28 APN 7 67559857 critical splice donor site probably null
IGL02483:Lrrc28 APN 7 67617983 splice site probably benign
IGL02750:Lrrc28 APN 7 67531683 missense probably damaging 0.96
R0549:Lrrc28 UTSW 7 67628342 splice site probably benign
R0563:Lrrc28 UTSW 7 67545387 missense probably damaging 1.00
R0650:Lrrc28 UTSW 7 67618085 missense probably damaging 1.00
R0652:Lrrc28 UTSW 7 67618085 missense probably damaging 1.00
R1557:Lrrc28 UTSW 7 67559929 missense probably damaging 1.00
R1820:Lrrc28 UTSW 7 67641111 missense probably damaging 0.98
R2149:Lrrc28 UTSW 7 67531682 missense probably damaging 0.96
R2185:Lrrc28 UTSW 7 67545453 missense possibly damaging 0.70
R4479:Lrrc28 UTSW 7 67531614 critical splice donor site probably null
R7008:Lrrc28 UTSW 7 67595711 intron probably benign
Z1088:Lrrc28 UTSW 7 67529631 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTTTGTTTCCTGACTGAGACAG -3'
(R):5'- TGAGTGACACTGTAACCTGCAC -3'

Sequencing Primer
(F):5'- TTTCCTGACTGAGACAGCAGGG -3'
(R):5'- GTAACCTGCACTCCAGCTG -3'
Posted On2016-07-06