Incidental Mutation 'R5205:Mfhas1'
ID398432
Institutional Source Beutler Lab
Gene Symbol Mfhas1
Ensembl Gene ENSMUSG00000070056
Gene Namemalignant fibrous histiocytoma amplified sequence 1
Synonyms2310066G09Rik, D8Ertd91e
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location35587798-35679449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35591007 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 879 (E879K)
Ref Sequence ENSEMBL: ENSMUSP00000044135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037666]
Predicted Effect probably benign
Transcript: ENSMUST00000037666
AA Change: E879K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: E879K

DomainStartEndE-ValueType
LRR 58 81 1.97e1 SMART
LRR 82 105 5.72e-1 SMART
LRR 106 125 2.79e1 SMART
LRR 130 152 8.09e-1 SMART
LRR_TYP 153 175 7.78e-3 SMART
LRR 176 195 5.48e0 SMART
LRR 199 221 6.57e-1 SMART
LRR 222 244 3.98e1 SMART
LRR 245 267 1.25e-1 SMART
LRR 268 290 3.27e1 SMART
LRR 291 313 1.43e-1 SMART
LRR 314 334 1.12e1 SMART
LRR_TYP 337 360 4.11e-2 SMART
Pfam:Roc 407 537 6.9e-11 PFAM
low complexity region 743 750 N/A INTRINSIC
low complexity region 754 761 N/A INTRINSIC
low complexity region 808 820 N/A INTRINSIC
Blast:LY 1018 1038 7e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181322
Predicted Effect unknown
Transcript: ENSMUST00000209953
AA Change: E684K
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Mfhas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Mfhas1 APN 8 35590771 missense probably benign 0.00
IGL00841:Mfhas1 APN 8 35590886 missense probably damaging 0.97
IGL01548:Mfhas1 APN 8 35590459 missense probably damaging 1.00
IGL02031:Mfhas1 APN 8 35589372 missense probably damaging 0.99
IGL02093:Mfhas1 APN 8 35589344 missense probably damaging 1.00
IGL02314:Mfhas1 APN 8 35588773 missense probably damaging 0.98
IGL02412:Mfhas1 APN 8 35588815 missense probably benign 0.11
IGL02638:Mfhas1 APN 8 35590950 missense possibly damaging 0.55
IGL02663:Mfhas1 APN 8 35589906 missense probably damaging 0.99
R0545:Mfhas1 UTSW 8 35589048 missense probably damaging 1.00
R0619:Mfhas1 UTSW 8 35590675 missense probably benign 0.00
R0637:Mfhas1 UTSW 8 35590026 nonsense probably null
R1251:Mfhas1 UTSW 8 35591053 missense probably damaging 0.97
R1829:Mfhas1 UTSW 8 35590068 missense probably benign
R1829:Mfhas1 UTSW 8 35590248 missense probably benign 0.09
R1839:Mfhas1 UTSW 8 35590858 missense possibly damaging 0.95
R1934:Mfhas1 UTSW 8 35591097 missense possibly damaging 0.52
R1937:Mfhas1 UTSW 8 35589645 missense probably damaging 0.99
R2038:Mfhas1 UTSW 8 35591277 missense probably damaging 1.00
R2982:Mfhas1 UTSW 8 35591115 missense probably benign 0.07
R4566:Mfhas1 UTSW 8 35591049 missense probably damaging 1.00
R4604:Mfhas1 UTSW 8 35588610 missense probably benign 0.00
R4693:Mfhas1 UTSW 8 35589175 missense probably damaging 1.00
R5535:Mfhas1 UTSW 8 35590269 missense possibly damaging 0.73
R5631:Mfhas1 UTSW 8 35588419 missense probably damaging 0.96
R5744:Mfhas1 UTSW 8 35589482 missense probably damaging 1.00
R6580:Mfhas1 UTSW 8 35589265 missense probably damaging 1.00
R6663:Mfhas1 UTSW 8 35589118 missense probably damaging 1.00
R6998:Mfhas1 UTSW 8 35591356 missense probably damaging 1.00
R7046:Mfhas1 UTSW 8 35664790 missense probably benign 0.00
R7054:Mfhas1 UTSW 8 35588638 missense probably benign 0.30
R7171:Mfhas1 UTSW 8 35588992 missense probably benign 0.08
X0060:Mfhas1 UTSW 8 35588404 missense possibly damaging 0.52
Z1088:Mfhas1 UTSW 8 35590236 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGGAGAAGATGGGACTCTGTTAC -3'
(R):5'- TGCCATGCGGTCCATATATTTG -3'

Sequencing Primer
(F):5'- GGGACTCTGTTACTGCCTCAATAAAC -3'
(R):5'- CCATATATTTGGTAGTGACGCATGGC -3'
Posted On2016-07-06