Incidental Mutation 'R5205:Slc17a5'
ID398438
Institutional Source Beutler Lab
Gene Symbol Slc17a5
Ensembl Gene ENSMUSG00000049624
Gene Namesolute carrier family 17 (anion/sugar transporter), member 5
Synonyms4631416G20Rik
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location78536488-78588041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78578617 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 62 (V62A)
Ref Sequence ENSEMBL: ENSMUSP00000113003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052441] [ENSMUST00000117645]
Predicted Effect probably damaging
Transcript: ENSMUST00000052441
AA Change: V62A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056182
Gene: ENSMUSG00000049624
AA Change: V62A

DomainStartEndE-ValueType
Pfam:MFS_1 46 441 1.8e-61 PFAM
transmembrane domain 456 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117645
AA Change: V62A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113003
Gene: ENSMUSG00000049624
AA Change: V62A

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Pfam:MFS_1 97 415 2.5e-50 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119213
SMART Domains Protein: ENSMUSP00000113340
Gene: ENSMUSG00000049624

DomainStartEndE-ValueType
Pfam:Sugar_tr 43 175 4.9e-8 PFAM
Pfam:MFS_1 45 189 5.5e-16 PFAM
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane transporter that exports free sialic acids that have been cleaved off of cell surface lipids and proteins from lysosomes. Mutations in this gene cause sialic acid storage diseases, including infantile sialic acid storage disorder and and Salla disease, an adult form. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit numerous neurological abnormalities, including impaired exploratory and locomotor activity, hearing deficits, and an increased depressive-like response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Slc17a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc17a5 APN 9 78578534 missense probably benign
IGL00828:Slc17a5 APN 9 78578551 missense probably benign 0.37
IGL01603:Slc17a5 APN 9 78574707 missense probably damaging 1.00
IGL01945:Slc17a5 APN 9 78587932 missense probably benign 0.01
IGL03250:Slc17a5 APN 9 78578564 missense probably damaging 0.99
PIT4618001:Slc17a5 UTSW 9 78538248 missense possibly damaging 0.52
R0136:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0245:Slc17a5 UTSW 9 78540924 missense probably benign 0.00
R0305:Slc17a5 UTSW 9 78557537 missense probably benign 0.25
R0481:Slc17a5 UTSW 9 78538302 splice site probably null
R0657:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0763:Slc17a5 UTSW 9 78553090 splice site probably benign
R1543:Slc17a5 UTSW 9 78560800 missense probably benign 0.01
R1564:Slc17a5 UTSW 9 78578699 missense probably damaging 0.98
R2155:Slc17a5 UTSW 9 78577173 missense probably damaging 1.00
R2483:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R3623:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R4193:Slc17a5 UTSW 9 78559106 missense possibly damaging 0.58
R4794:Slc17a5 UTSW 9 78574715 missense probably damaging 0.96
R5115:Slc17a5 UTSW 9 78577112 missense probably benign 0.12
R5141:Slc17a5 UTSW 9 78540988 missense probably damaging 1.00
R5953:Slc17a5 UTSW 9 78557498 missense probably damaging 1.00
R6481:Slc17a5 UTSW 9 78538271 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGATCCTGACCTGGGAAGAC -3'
(R):5'- GATAAAGGACTTATAAAGCCACAGC -3'

Sequencing Primer
(F):5'- TGACCTGGGAAGACTACCAAAC -3'
(R):5'- CTTTAATCTCAGCACTCGGAAGG -3'
Posted On2016-07-06