Incidental Mutation 'R5236:Slc4a9'
ID398453
Institutional Source Beutler Lab
Gene Symbol Slc4a9
Ensembl Gene ENSMUSG00000024485
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 9
SynonymsAE4, D630024F24Rik
MMRRC Submission 044393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5236 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36528157-36541293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36530847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 308 (Y308C)
Ref Sequence ENSEMBL: ENSMUSP00000111358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074298] [ENSMUST00000115694]
Predicted Effect probably benign
Transcript: ENSMUST00000074298
AA Change: Y308C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073910
Gene: ENSMUSG00000024485
AA Change: Y308C

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 174 4.6e-19 PFAM
Pfam:Band_3_cyto 161 300 7.1e-45 PFAM
Pfam:HCO3_cotransp 367 788 2.7e-168 PFAM
transmembrane domain 794 816 N/A INTRINSIC
low complexity region 830 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115694
AA Change: Y308C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111358
Gene: ENSMUSG00000024485
AA Change: Y308C

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 170 1.9e-15 PFAM
Pfam:Band_3_cyto 159 300 1e-38 PFAM
Pfam:HCO3_cotransp 349 805 3.1e-174 PFAM
Pfam:HCO3_cotransp 801 837 1.1e-11 PFAM
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 879 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in anion exchange. Expression of this gene is mostly limited to the kidney. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered ion exchange in intestinal epithelia and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,921 I180N possibly damaging Het
Actl9 T C 17: 33,434,099 S378P probably damaging Het
Agrn A T 4: 156,178,858 C263S possibly damaging Het
Ahnak A G 19: 9,000,684 I56V possibly damaging Het
Arid4b A G 13: 14,126,449 probably null Het
BC067074 A G 13: 113,366,220 Y153C probably benign Het
Bin2 T C 15: 100,662,534 N49D probably damaging Het
Ccdc39 T C 3: 33,830,102 T364A probably damaging Het
Cdcp1 A T 9: 123,185,193 V172D probably damaging Het
Cdh23 A G 10: 60,312,572 L2670P probably damaging Het
Cmtm4 G C 8: 104,357,746 F105L probably damaging Het
Ctsa G A 2: 164,838,911 V453M probably damaging Het
Cyp3a59 A G 5: 146,102,825 I303V probably benign Het
Cyp4f17 T C 17: 32,520,632 probably null Het
Dst C T 1: 34,164,417 R447C probably damaging Het
E2f7 C T 10: 110,767,209 P362S probably damaging Het
Fbxw9 A G 8: 85,066,345 T407A probably damaging Het
Fyb2 T C 4: 104,948,760 S346P probably benign Het
Git2 T A 5: 114,767,172 I75L probably damaging Het
H2-DMa T A 17: 34,137,939 L137Q probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrg T C 16: 22,961,513 probably benign Het
Htr7 A T 19: 36,056,769 I162N probably damaging Het
Itpripl1 A T 2: 127,141,850 F117L probably damaging Het
Kri1 T C 9: 21,275,941 Y392C probably damaging Het
Krt27 A C 11: 99,350,815 S87A possibly damaging Het
Lama1 T C 17: 67,804,492 V2246A probably benign Het
Lcn2 A T 2: 32,385,961 M119K probably benign Het
Lrp2 T C 2: 69,456,819 probably null Het
Lrp6 T C 6: 134,511,264 N290D probably damaging Het
Macf1 T C 4: 123,397,821 E2517G probably damaging Het
Melk G A 4: 44,344,959 C363Y probably benign Het
Mettl22 T A 16: 8,488,733 L351* probably null Het
Mms22l A G 4: 24,588,347 Q953R probably benign Het
Ndufaf7 T C 17: 78,939,631 S107P probably benign Het
Olfr446 A C 6: 42,927,781 R183S probably benign Het
Olfr459 C A 6: 41,772,111 G63C probably benign Het
Opa3 A G 7: 19,244,757 Y49C probably damaging Het
Pabpn1 T A 14: 54,894,942 M145K possibly damaging Het
Plce1 A C 19: 38,770,347 M1982L probably benign Het
Ppcdc A C 9: 57,414,654 I201S probably benign Het
Rag2 A T 2: 101,629,660 D105V probably damaging Het
Rnf130 C T 11: 50,095,978 T383I probably damaging Het
Sgip1 T G 4: 102,927,587 probably null Het
Slc23a2 T A 2: 132,075,584 I245F probably damaging Het
Slc7a15 C T 12: 8,539,005 V181M probably benign Het
Sprr2b G A 3: 92,317,636 C63Y unknown Het
Stpg2 A T 3: 139,232,223 Y181F probably damaging Het
Sult2a5 A T 7: 13,665,049 T194S probably benign Het
Tbx15 A T 3: 99,352,046 Q411L possibly damaging Het
Tln2 T A 9: 67,365,923 E427V probably damaging Het
Trpv4 A C 5: 114,622,795 V825G possibly damaging Het
Trrap A G 5: 144,817,786 I1968V probably benign Het
Ttn G A 2: 76,788,802 L16078F probably damaging Het
Unc45b T A 11: 82,915,062 F132I possibly damaging Het
Unc79 T A 12: 103,094,395 probably null Het
Vmn2r71 A T 7: 85,623,669 N564Y probably damaging Het
Zfp638 G T 6: 83,976,575 E1221* probably null Het
Zfp934 A T 13: 62,517,713 H371Q probably damaging Het
Zranb3 A G 1: 128,040,989 L63P probably damaging Het
Other mutations in Slc4a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc4a9 APN 18 36539596 splice site probably benign
IGL01890:Slc4a9 APN 18 36529707 missense possibly damaging 0.63
IGL01995:Slc4a9 APN 18 36539775 missense possibly damaging 0.64
IGL02293:Slc4a9 APN 18 36533215 missense probably benign 0.00
IGL02476:Slc4a9 APN 18 36535445 critical splice donor site probably null
IGL02690:Slc4a9 APN 18 36531987 missense probably damaging 1.00
IGL02726:Slc4a9 APN 18 36539617 missense probably benign 0.24
IGL03003:Slc4a9 APN 18 36536893 missense probably damaging 1.00
IGL03344:Slc4a9 APN 18 36535601 missense probably damaging 1.00
IGL03410:Slc4a9 APN 18 36529687 missense probably benign
R0025:Slc4a9 UTSW 18 36531666 splice site probably benign
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0330:Slc4a9 UTSW 18 36535539 missense probably damaging 1.00
R0457:Slc4a9 UTSW 18 36535418 missense probably damaging 1.00
R0831:Slc4a9 UTSW 18 36535278 splice site probably benign
R0989:Slc4a9 UTSW 18 36536867 nonsense probably null
R1016:Slc4a9 UTSW 18 36531425 missense probably benign 0.12
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1598:Slc4a9 UTSW 18 36528371 nonsense probably null
R1710:Slc4a9 UTSW 18 36532022 missense probably benign
R2041:Slc4a9 UTSW 18 36530793 missense possibly damaging 0.93
R2216:Slc4a9 UTSW 18 36530745 missense probably benign 0.05
R3899:Slc4a9 UTSW 18 36535563 missense probably benign 0.09
R5902:Slc4a9 UTSW 18 36529333 splice site probably null
R5902:Slc4a9 UTSW 18 36531507 missense probably damaging 1.00
R5978:Slc4a9 UTSW 18 36535403 missense probably damaging 1.00
R6438:Slc4a9 UTSW 18 36535687 missense probably benign 0.00
R6452:Slc4a9 UTSW 18 36531459 missense probably damaging 1.00
R7238:Slc4a9 UTSW 18 36529720 missense probably benign 0.00
R7329:Slc4a9 UTSW 18 36540821 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTGAACACACATGGAAGAGTCC -3'
(R):5'- GATTTGACTTAAGAGTACGCGACG -3'

Sequencing Primer
(F):5'- GGAAGAGTCCTTAATATGCACTTCCC -3'
(R):5'- ATGCCAAGCTTAACTGGG -3'
Posted On2016-07-06