Incidental Mutation 'R5205:Wnk4'
ID398458
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene NameWNK lysine deficient protein kinase 4
Synonyms2010002J11Rik, Prkwnk4
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101260567-101277409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101265138 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 407 (E407G)
Ref Sequence ENSEMBL: ENSMUSP00000099397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103108] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000170056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103108
AA Change: E407G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: E407G

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139487
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147741
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156205
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101268748 missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101264349 missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101276683 splice site probably benign
IGL01931:Wnk4 APN 11 101268484 missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101265414 missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101275291 unclassified probably benign
IGL02197:Wnk4 APN 11 101263957 missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101269563 splice site probably benign
IGL02963:Wnk4 APN 11 101276213 unclassified probably benign
Caught_dead UTSW 11 101264330 missense probably damaging 1.00
mortification UTSW 11 101263894 makesense probably null
shame UTSW 11 101262856 missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101265435 missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101268804 missense probably benign 0.01
R0628:Wnk4 UTSW 11 101275023 missense probably benign 0.10
R0630:Wnk4 UTSW 11 101265386 missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101274106 missense probably benign 0.22
R1290:Wnk4 UTSW 11 101276340 unclassified probably benign
R1482:Wnk4 UTSW 11 101269636 missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101276340 unclassified probably benign
R2005:Wnk4 UTSW 11 101263890 missense probably damaging 1.00
R2229:Wnk4 UTSW 11 101275641 unclassified probably benign
R2258:Wnk4 UTSW 11 101275035 missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101268481 missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101276891 splice site probably benign
R3763:Wnk4 UTSW 11 101269288 missense probably benign 0.00
R4196:Wnk4 UTSW 11 101269631 missense probably damaging 1.00
R4447:Wnk4 UTSW 11 101268451 missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101274111 missense probably benign 0.00
R4751:Wnk4 UTSW 11 101276362 unclassified probably benign
R4948:Wnk4 UTSW 11 101268281 missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101262856 missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101261188 missense probably damaging 1.00
R5107:Wnk4 UTSW 11 101275538 unclassified probably benign
R5181:Wnk4 UTSW 11 101265377 missense probably damaging 0.96
R5252:Wnk4 UTSW 11 101268748 missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101263869 missense probably damaging 1.00
R5293:Wnk4 UTSW 11 101275197 unclassified probably benign
R5609:Wnk4 UTSW 11 101275636 unclassified probably benign
R5915:Wnk4 UTSW 11 101263894 makesense probably null
R5931:Wnk4 UTSW 11 101261221 missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101276348 unclassified probably benign
R6164:Wnk4 UTSW 11 101275068 missense possibly damaging 0.56
R6191:Wnk4 UTSW 11 101264330 missense probably damaging 1.00
R6267:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101265431 missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101261200 missense probably benign 0.22
R7251:Wnk4 UTSW 11 101265153 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGCCCTTCACACAAGCTGG -3'
(R):5'- AACTCGATGGCCTGGTTGTC -3'

Sequencing Primer
(F):5'- CGGAAATCGAGTTTTCAGTACCAGC -3'
(R):5'- TTGAGGCCCGGCTTCTC -3'
Posted On2016-07-06