Incidental Mutation 'R5205:Asb16'
ID398460
Institutional Source Beutler Lab
Gene Symbol Asb16
Ensembl Gene ENSMUSG00000034768
Gene Nameankyrin repeat and SOCS box-containing 16
Synonyms
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102268743-102279462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102268994 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 58 (D58N)
Ref Sequence ENSEMBL: ENSMUSP00000038450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036467] [ENSMUST00000100392] [ENSMUST00000133930]
Predicted Effect probably damaging
Transcript: ENSMUST00000036467
AA Change: D58N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038450
Gene: ENSMUSG00000034768
AA Change: D58N

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Blast:ANK 56 85 3e-9 BLAST
ANK 110 139 5.29e0 SMART
ANK 142 171 2.1e-3 SMART
ANK 175 204 5.93e-3 SMART
ANK 209 238 1.4e1 SMART
ANK 242 279 9.21e0 SMART
ANK 283 312 2.18e-1 SMART
Blast:ANK 316 352 7e-17 BLAST
Blast:ANK 354 379 2e-8 BLAST
SOCS_box 408 447 1.26e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100392
SMART Domains Protein: ENSMUSP00000097961
Gene: ENSMUSG00000034773

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 100 108 N/A INTRINSIC
low complexity region 302 317 N/A INTRINSIC
Pfam:DUF4539 458 541 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133930
SMART Domains Protein: ENSMUSP00000137686
Gene: ENSMUSG00000034773

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 100 108 N/A INTRINSIC
low complexity region 302 317 N/A INTRINSIC
Pfam:DUF4539 457 542 3.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140040
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Asb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Asb16 APN 11 102276749 missense probably damaging 1.00
R1540:Asb16 UTSW 11 102272576 missense probably benign 0.37
R1589:Asb16 UTSW 11 102268995 missense probably damaging 1.00
R1845:Asb16 UTSW 11 102276756 missense possibly damaging 0.54
R2379:Asb16 UTSW 11 102272531 missense probably benign 0.00
R3686:Asb16 UTSW 11 102269059 missense probably benign 0.19
R4591:Asb16 UTSW 11 102276725 missense probably damaging 0.97
R6505:Asb16 UTSW 11 102276477 missense probably damaging 0.99
R6649:Asb16 UTSW 11 102269037 missense possibly damaging 0.56
R7275:Asb16 UTSW 11 102269109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGGAGAGCTTTCCTTTC -3'
(R):5'- TATGGGTCCGTTCTAGGCTC -3'

Sequencing Primer
(F):5'- AGGGGAGAGCTTTCCTTTCACATC -3'
(R):5'- CCGTTCTAGGCTCTTTACGGAGAAG -3'
Posted On2016-07-06