Incidental Mutation 'R5237:Il15ra'
ID398467
Institutional Source Beutler Lab
Gene Symbol Il15ra
Ensembl Gene ENSMUSG00000023206
Gene Nameinterleukin 15 receptor, alpha chain
Synonyms
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11705290-11734317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11733205 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 250 (T250A)
Ref Sequence ENSEMBL: ENSMUSP00000077878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078834] [ENSMUST00000114831] [ENSMUST00000114832] [ENSMUST00000114833] [ENSMUST00000114834] [ENSMUST00000123600] [ENSMUST00000128156] [ENSMUST00000135341] [ENSMUST00000138349] [ENSMUST00000148748]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078834
AA Change: T250A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206
AA Change: T250A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091456
Predicted Effect possibly damaging
Transcript: ENSMUST00000114831
AA Change: T217A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206
AA Change: T217A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114832
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206
AA Change: T142A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114833
AA Change: T153A

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206
AA Change: T153A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114834
AA Change: T184A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206
AA Change: T184A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123600
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126394
SMART Domains Protein: ENSMUSP00000131640
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128156
AA Change: T110A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126364
Gene: ENSMUSG00000023206
AA Change: T110A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135341
AA Change: T110A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206
AA Change: T110A

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138349
AA Change: T110A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131473
Gene: ENSMUSG00000023206
AA Change: T110A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139774
Predicted Effect probably benign
Transcript: ENSMUST00000148748
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191662
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mutation of this gene results in absence of NK cell production in spleen and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Il15ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Il15ra APN 2 11733145 splice site probably benign
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0945:Il15ra UTSW 2 11718327 missense probably damaging 0.96
R1863:Il15ra UTSW 2 11723436 missense possibly damaging 0.85
R1975:Il15ra UTSW 2 11723523 missense possibly damaging 0.94
R2172:Il15ra UTSW 2 11723571 missense possibly damaging 0.94
R2202:Il15ra UTSW 2 11718344 critical splice donor site probably null
R3709:Il15ra UTSW 2 11730647 critical splice donor site probably null
R3710:Il15ra UTSW 2 11730647 critical splice donor site probably null
R4621:Il15ra UTSW 2 11718329 missense possibly damaging 0.95
R4701:Il15ra UTSW 2 11718345 splice site probably null
R4779:Il15ra UTSW 2 11718306 missense probably damaging 0.98
R4844:Il15ra UTSW 2 11718271 start gained probably benign
R5810:Il15ra UTSW 2 11733252 unclassified probably null
R5880:Il15ra UTSW 2 11730615 makesense probably null
R6160:Il15ra UTSW 2 11720016 missense probably damaging 0.99
R7291:Il15ra UTSW 2 11718381 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCACAGACCTCTGAGAG -3'
(R):5'- GATCCAGGCCTGAATATGGGAG -3'

Sequencing Primer
(F):5'- CACAGACCTCTGAGAGTGGGG -3'
(R):5'- CCTGAATATGGGAGGCACC -3'
Posted On2016-07-06