Incidental Mutation 'R5237:Mymk'
ID398472
Institutional Source Beutler Lab
Gene Symbol Mymk
Ensembl Gene ENSMUSG00000009214
Gene Namemyomaker, myoblast fusion factor
Synonyms1110002H13Rik, Tmem8c
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5237 (G1)
Quality Score152
Status Validated
Chromosome2
Chromosomal Location27061636-27072179 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 27062188 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 181 (*181W)
Ref Sequence ENSEMBL: ENSMUSP00000128491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009358] [ENSMUST00000163967]
Predicted Effect probably null
Transcript: ENSMUST00000009358
AA Change: *222W
SMART Domains Protein: ENSMUSP00000009358
Gene: ENSMUSG00000009214
AA Change: *222W

DomainStartEndE-ValueType
Pfam:DUF3522 3 185 1.1e-48 PFAM
low complexity region 196 210 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163967
AA Change: *181W
SMART Domains Protein: ENSMUSP00000128491
Gene: ENSMUSG00000009214
AA Change: *181W

DomainStartEndE-ValueType
Pfam:DUF3522 4 144 9e-41 PFAM
low complexity region 155 169 N/A INTRINSIC
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early postnatal lethality, paralysis, kyphosis and defective myoblast fusion and survival leading to the absence of differentiated muscle in the trunk, limb and head. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Mymk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mymk APN 2 27062787 missense probably damaging 1.00
IGL01947:Mymk APN 2 27066394 missense possibly damaging 0.93
R0173:Mymk UTSW 2 27062250 missense probably damaging 1.00
R0322:Mymk UTSW 2 27067406 missense probably damaging 1.00
R1686:Mymk UTSW 2 27062334 missense probably damaging 1.00
R4583:Mymk UTSW 2 27062280 missense probably benign 0.01
R4610:Mymk UTSW 2 27062707 missense probably damaging 1.00
R5147:Mymk UTSW 2 27062287 missense probably benign 0.14
R5220:Mymk UTSW 2 27062214 missense probably benign 0.00
R6189:Mymk UTSW 2 27067365 missense possibly damaging 0.53
R6610:Mymk UTSW 2 27067393 missense possibly damaging 0.94
R7257:Mymk UTSW 2 27067368 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGTGAACACAGAACCAGTG -3'
(R):5'- ACCAAATGGCTAGGACTTGG -3'

Sequencing Primer
(F):5'- TGGGTCCCTAAGCAGCACTC -3'
(R):5'- ACCAAATGGCTAGGACTTGGTTTAG -3'
Posted On2016-07-06