Incidental Mutation 'R5205:Adamts19'
ID398482
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
SynonymsD230034E10Rik
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58836764-59053678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58968808 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 650 (R650Q)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
Predicted Effect probably damaging
Transcript: ENSMUST00000052907
AA Change: R650Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: R650Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59024465 missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59007325 splice site probably benign
IGL00970:Adamts19 APN 18 59011077 missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59048882 missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 58972779 missense probably damaging 0.98
IGL01529:Adamts19 APN 18 58963463 missense probably damaging 0.99
IGL01535:Adamts19 APN 18 58968819 missense probably benign 0.00
IGL01557:Adamts19 APN 18 58968720 splice site probably null
IGL01705:Adamts19 APN 18 59032966 missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 58952469 missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58837499 missense probably benign
IGL02131:Adamts19 APN 18 59052660 missense probably damaging 1.00
IGL02312:Adamts19 APN 18 58927297 missense probably damaging 1.00
IGL02755:Adamts19 APN 18 58969933 missense probably benign 0.25
IGL02866:Adamts19 APN 18 59048842 missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 58988965 missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59024518 missense probably damaging 1.00
IGL03040:Adamts19 APN 18 58903008 missense probably benign 0.05
R0081:Adamts19 UTSW 18 58903065 critical splice donor site probably null
R0194:Adamts19 UTSW 18 59011148 missense probably null 1.00
R0195:Adamts19 UTSW 18 58969870 splice site probably benign
R0541:Adamts19 UTSW 18 58927300 critical splice donor site probably null
R0659:Adamts19 UTSW 18 59007493 splice site probably benign
R0967:Adamts19 UTSW 18 58972740 nonsense probably null
R1512:Adamts19 UTSW 18 59048845 missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59052615 missense probably damaging 1.00
R1582:Adamts19 UTSW 18 58969941 missense probably damaging 0.98
R1629:Adamts19 UTSW 18 58954619 missense probably damaging 0.97
R1653:Adamts19 UTSW 18 58890293 missense probably benign 0.00
R1718:Adamts19 UTSW 18 58972825 missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59031929 missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59007372 missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 58954620 missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59032945 missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 58970006 missense probably benign 0.09
R1994:Adamts19 UTSW 18 58972831 critical splice donor site probably null
R2177:Adamts19 UTSW 18 58954554 missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 58900910 missense probably damaging 1.00
R4342:Adamts19 UTSW 18 58942500 missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58837776 missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 58890284 missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59033000 missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59031804 nonsense probably null
R5116:Adamts19 UTSW 18 58902994 missense possibly damaging 0.52
R5765:Adamts19 UTSW 18 59052582 missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58837968 missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58837512 missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 58968774 missense probably benign 0.18
R6088:Adamts19 UTSW 18 58902102 missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58837640 nonsense probably null
R7251:Adamts19 UTSW 18 58837902 missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58837883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTAATTCCAGTGACTGTGTAG -3'
(R):5'- TGAAAGCCTGATCACTGTTTGC -3'

Sequencing Primer
(F):5'- ATTCCAGTGACTGTGTAGACCAG -3'
(R):5'- CACTGTTTGCTTCTTAAAGGAGACG -3'
Posted On2016-07-06