Incidental Mutation 'R5205:Olfr1477'
ID398487
Institutional Source Beutler Lab
Gene Symbol Olfr1477
Ensembl Gene ENSMUSG00000071629
Gene Nameolfactory receptor 1477
SynonymsMOR202-10, GA_x6K02T2RE5P-3834960-3835907
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13500546-13506192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13502799 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 152 (L152P)
Ref Sequence ENSEMBL: ENSMUSP00000149565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096201] [ENSMUST00000214274] [ENSMUST00000217001]
Predicted Effect probably damaging
Transcript: ENSMUST00000096201
AA Change: L152P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: L152P

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208393
Predicted Effect probably damaging
Transcript: ENSMUST00000214274
AA Change: L152P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217001
AA Change: L152P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Olfr1477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Olfr1477 APN 19 13502741 missense possibly damaging 0.55
IGL02394:Olfr1477 APN 19 13502864 missense probably damaging 0.97
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0356:Olfr1477 UTSW 19 13503077 missense possibly damaging 0.74
R0617:Olfr1477 UTSW 19 13502536 missense probably damaging 1.00
R1589:Olfr1477 UTSW 19 13502757 missense probably benign 0.03
R1725:Olfr1477 UTSW 19 13502519 missense probably damaging 1.00
R2153:Olfr1477 UTSW 19 13502488 missense probably damaging 1.00
R2362:Olfr1477 UTSW 19 13502508 missense probably damaging 1.00
R3402:Olfr1477 UTSW 19 13502948 missense probably benign 0.11
R4513:Olfr1477 UTSW 19 13502622 missense probably benign 0.05
R5197:Olfr1477 UTSW 19 13502384 missense possibly damaging 0.68
R5511:Olfr1477 UTSW 19 13503192 missense probably benign 0.12
R5838:Olfr1477 UTSW 19 13502558 missense probably damaging 1.00
R6023:Olfr1477 UTSW 19 13502703 missense probably damaging 1.00
R6232:Olfr1477 UTSW 19 13503063 missense probably damaging 1.00
R6700:Olfr1477 UTSW 19 13502813 missense probably damaging 0.97
R6769:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R6771:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R7002:Olfr1477 UTSW 19 13502675 missense probably benign 0.00
R7057:Olfr1477 UTSW 19 13502879 missense probably damaging 1.00
R7320:Olfr1477 UTSW 19 13503180 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CATGTGCTGCCCAGATGTTC -3'
(R):5'- CGCATTCTCACAATTGCAACAG -3'

Sequencing Primer
(F):5'- GCCCAGATGTTCTTCTTTGTAG -3'
(R):5'- ATTCTCACAATTGCAACAGAAATTAG -3'
Posted On2016-07-06