Incidental Mutation 'R5237:Tesk1'
ID398488
Institutional Source Beutler Lab
Gene Symbol Tesk1
Ensembl Gene ENSMUSG00000028458
Gene Nametestis specific protein kinase 1
Synonyms
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43441939-43448064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43447100 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 496 (F496S)
Ref Sequence ENSEMBL: ENSMUSP00000050087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030179] [ENSMUST00000060864] [ENSMUST00000098104] [ENSMUST00000098105] [ENSMUST00000107925] [ENSMUST00000107926] [ENSMUST00000138981]
Predicted Effect probably benign
Transcript: ENSMUST00000030179
SMART Domains Protein: ENSMUSP00000030179
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 348 2.28e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060864
AA Change: F496S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050087
Gene: ENSMUSG00000028458
AA Change: F496S

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 306 5.4e-46 PFAM
Pfam:Pkinase_Tyr 52 306 3.1e-47 PFAM
low complexity region 316 330 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 403 424 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098104
SMART Domains Protein: ENSMUSP00000095708
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
coiled coil region 83 169 N/A INTRINSIC
CLECT 178 287 2.48e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098105
SMART Domains Protein: ENSMUSP00000095709
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 113 199 N/A INTRINSIC
CLECT 208 324 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107925
SMART Domains Protein: ENSMUSP00000103558
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 334 2.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107926
SMART Domains Protein: ENSMUSP00000103559
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 341 2.48e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137178
Predicted Effect probably benign
Transcript: ENSMUST00000138981
SMART Domains Protein: ENSMUSP00000121067
Gene: ENSMUSG00000028458

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 174 7.6e-29 PFAM
Pfam:Pkinase_Tyr 52 175 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156810
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Tesk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Tesk1 APN 4 43445820 critical splice donor site probably null
IGL02969:Tesk1 APN 4 43447027 missense possibly damaging 0.49
IGL02969:Tesk1 APN 4 43447026 nonsense probably null
FR4449:Tesk1 UTSW 4 43447002 utr 3 prime probably benign
FR4737:Tesk1 UTSW 4 43447004 frame shift probably null
R0009:Tesk1 UTSW 4 43445368 missense probably damaging 0.99
R0396:Tesk1 UTSW 4 43446000 missense probably damaging 0.99
R0765:Tesk1 UTSW 4 43446706 missense possibly damaging 0.81
R1850:Tesk1 UTSW 4 43443576 missense probably damaging 1.00
R1868:Tesk1 UTSW 4 43447201 missense probably damaging 0.99
R1903:Tesk1 UTSW 4 43446998 missense probably benign 0.00
R3961:Tesk1 UTSW 4 43445133 splice site probably null
R3973:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3975:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3976:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R4074:Tesk1 UTSW 4 43443606 missense possibly damaging 0.88
R4908:Tesk1 UTSW 4 43445555 nonsense probably null
R5002:Tesk1 UTSW 4 43444573 missense probably damaging 1.00
R6755:Tesk1 UTSW 4 43445991 missense probably benign 0.03
R6886:Tesk1 UTSW 4 43443592 missense possibly damaging 0.72
R6991:Tesk1 UTSW 4 43447006 missense probably benign
R6992:Tesk1 UTSW 4 43447006 missense probably benign
R6993:Tesk1 UTSW 4 43447006 missense probably benign
X0064:Tesk1 UTSW 4 43443534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCACTCCAGACATCCTG -3'
(R):5'- CACAGTTCAAGTTGCGGTAGC -3'

Sequencing Primer
(F):5'- ATCCTGGTCCAGCCTGAGAC -3'
(R):5'- GCCAAAGCTGAACGGGC -3'
Posted On2016-07-06