Incidental Mutation 'R5205:Slk'
ID398489
Institutional Source Beutler Lab
Gene Symbol Slk
Ensembl Gene ENSMUSG00000025060
Gene NameSTE20-like kinase
Synonyms9A2, Stk2, mSLK, Etk4, SLK
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47579678-47645246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47625460 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 918 (N918K)
Ref Sequence ENSEMBL: ENSMUSP00000049977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026043] [ENSMUST00000051691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026043
AA Change: N918K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026043
Gene: ENSMUSG00000025060
AA Change: N918K

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 849 928 1.2e-19 PFAM
Pfam:PKK 986 1127 7.4e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051691
AA Change: N918K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049977
Gene: ENSMUSG00000025060
AA Change: N918K

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 850 988 1.6e-40 PFAM
Pfam:PKK 1018 1158 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130115
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die by E14.5, exhibiting severe developmental defects, impaired neuronal and skeletal muscle development, abnormal placental differentiation and vascularization, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Edem3 A T 1: 151,811,519 D717V probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Slk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Slk APN 19 47619709 missense probably benign 0.00
IGL00515:Slk APN 19 47642096 unclassified probably benign
IGL00755:Slk APN 19 47609010 missense probably damaging 0.99
IGL00990:Slk APN 19 47580252 missense probably damaging 0.98
IGL02283:Slk APN 19 47641993 missense probably damaging 1.00
R0140:Slk UTSW 19 47622335 missense probably damaging 1.00
R0364:Slk UTSW 19 47620189 nonsense probably null
R0944:Slk UTSW 19 47608993 missense probably damaging 1.00
R1756:Slk UTSW 19 47622677 missense probably damaging 0.97
R1795:Slk UTSW 19 47620534 missense possibly damaging 0.72
R1869:Slk UTSW 19 47625452 missense probably damaging 1.00
R1980:Slk UTSW 19 47611989 missense probably damaging 1.00
R2261:Slk UTSW 19 47637352 missense probably damaging 0.99
R2278:Slk UTSW 19 47619749 missense probably damaging 0.97
R3746:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3748:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3749:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3750:Slk UTSW 19 47619809 missense possibly damaging 0.88
R4024:Slk UTSW 19 47622370 splice site probably null
R4471:Slk UTSW 19 47615423 missense probably damaging 1.00
R4647:Slk UTSW 19 47620274 missense possibly damaging 0.71
R4825:Slk UTSW 19 47619956 missense probably benign
R5228:Slk UTSW 19 47625332 missense probably damaging 1.00
R5372:Slk UTSW 19 47625393 missense probably damaging 1.00
R5665:Slk UTSW 19 47636457 missense probably damaging 1.00
R5688:Slk UTSW 19 47620012 missense probably benign 0.00
R5859:Slk UTSW 19 47609042 missense probably benign 0.37
R6279:Slk UTSW 19 47642004 missense probably damaging 1.00
R6368:Slk UTSW 19 47620183 missense possibly damaging 0.85
R6431:Slk UTSW 19 47620888 missense probably damaging 1.00
R6563:Slk UTSW 19 47636469 critical splice donor site probably null
R6705:Slk UTSW 19 47609059 missense probably benign 0.01
R6790:Slk UTSW 19 47635568 missense probably damaging 0.96
X0052:Slk UTSW 19 47620933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCCAGTGCTTTTGTGGTC -3'
(R):5'- CACTAACTGCCAGCCTATCATTG -3'

Sequencing Primer
(F):5'- AATTGCAGGCATGTGCTACC -3'
(R):5'- GCCAGCCTATCATTGTTTGGAAGAC -3'
Posted On2016-07-06