Incidental Mutation 'R5231:4931408C20Rik'
ID398493
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5231 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26683951 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 716 (H716L)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097801
AA Change: H716L

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: H716L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr1499 A T 19: 13,815,347 I81N probably damaging Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7085:4931408C20Rik UTSW 1 26683465 missense possibly damaging 0.95
R7183:4931408C20Rik UTSW 1 26682833 missense probably benign 0.27
R7347:4931408C20Rik UTSW 1 26684467 missense probably benign 0.02
R7488:4931408C20Rik UTSW 1 26683958 missense possibly damaging 0.77
R7565:4931408C20Rik UTSW 1 26685270 missense probably benign 0.00
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGGGGAGGAAATACATTGTCATTC -3'
(R):5'- CAGTGAGATTCCCAATGGGC -3'

Sequencing Primer
(F):5'- GGAGGAAATACATTGTCATTCTTTGC -3'
(R):5'- TGGGCAAGCCATCAATATTACTCTC -3'
Posted On2016-07-06