Incidental Mutation 'R5237:Cog7'
ID398527
Institutional Source Beutler Lab
Gene Symbol Cog7
Ensembl Gene ENSMUSG00000034951
Gene Namecomponent of oligomeric golgi complex 7
Synonyms
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121879363-121981711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121951221 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 360 (L360P)
Ref Sequence ENSEMBL: ENSMUSP00000146193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057576] [ENSMUST00000205438]
Predicted Effect probably damaging
Transcript: ENSMUST00000057576
AA Change: L360P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058990
Gene: ENSMUSG00000034951
AA Change: L360P

DomainStartEndE-ValueType
Pfam:COG7 2 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148634
Predicted Effect probably damaging
Transcript: ENSMUST00000205438
AA Change: L360P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Med24 T C 11: 98,710,783 Y524C probably damaging Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Cog7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Cog7 APN 7 121943777 critical splice donor site probably null
IGL02094:Cog7 APN 7 121963247 missense probably benign 0.21
IGL02113:Cog7 APN 7 121925480 missense probably damaging 1.00
IGL02151:Cog7 APN 7 121943808 missense probably damaging 0.97
IGL02365:Cog7 APN 7 121977736 missense possibly damaging 0.56
IGL02398:Cog7 APN 7 121964209 missense probably damaging 1.00
IGL02732:Cog7 APN 7 121923367 missense probably benign 0.05
IGL02887:Cog7 APN 7 121943844 missense possibly damaging 0.83
R0143:Cog7 UTSW 7 121951164 missense probably damaging 1.00
R0446:Cog7 UTSW 7 121937072 missense probably benign
R0521:Cog7 UTSW 7 121941169 critical splice donor site probably null
R0526:Cog7 UTSW 7 121963271 splice site probably null
R0658:Cog7 UTSW 7 121956140 splice site probably benign
R0782:Cog7 UTSW 7 121943797 missense possibly damaging 0.86
R1029:Cog7 UTSW 7 121930529 critical splice donor site probably null
R1419:Cog7 UTSW 7 121955992 missense probably damaging 0.99
R1521:Cog7 UTSW 7 121930574 missense possibly damaging 0.57
R1639:Cog7 UTSW 7 121981419 missense probably damaging 1.00
R2023:Cog7 UTSW 7 121936970 missense probably damaging 0.99
R3896:Cog7 UTSW 7 121941169 critical splice donor site probably benign
R4240:Cog7 UTSW 7 121925484 missense possibly damaging 0.50
R4731:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4732:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4733:Cog7 UTSW 7 121964244 missense probably benign 0.00
R4838:Cog7 UTSW 7 121971381 missense probably damaging 1.00
R5001:Cog7 UTSW 7 121949886 missense probably damaging 1.00
R5353:Cog7 UTSW 7 121941247 splice site probably null
R5609:Cog7 UTSW 7 121925460 missense probably benign 0.12
R5964:Cog7 UTSW 7 121956029 missense probably damaging 0.99
R6544:Cog7 UTSW 7 121935743 missense probably damaging 0.99
R6784:Cog7 UTSW 7 121964293 splice site probably null
R7110:Cog7 UTSW 7 121935776 missense probably damaging 0.98
R7212:Cog7 UTSW 7 121977314 missense probably damaging 0.98
R7304:Cog7 UTSW 7 121937139 missense probably benign 0.04
X0066:Cog7 UTSW 7 121977624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGGTAGCTTCACTTTCTC -3'
(R):5'- TAATGAGGGAATGTGCCAGC -3'

Sequencing Primer
(F):5'- GTGTGTACCTGAGACATTACAAACC -3'
(R):5'- GGAATGTGCCAGCAGAATACCTTTC -3'
Posted On2016-07-06