Incidental Mutation 'R5237:Med24'
ID398556
Institutional Source Beutler Lab
Gene Symbol Med24
Ensembl Gene ENSMUSG00000017210
Gene Namemediator complex subunit 24
SynonymsTrap100, 100kDa, Thrap4, Pparb2, R75526, DRIP100, Gse2, D11Ertd307e
MMRRC Submission 042808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5237 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98704591-98729435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98710783 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 524 (Y524C)
Ref Sequence ENSEMBL: ENSMUSP00000098069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000100500] [ENSMUST00000138750]
Predicted Effect probably damaging
Transcript: ENSMUST00000017354
AA Change: Y505C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210
AA Change: Y505C

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100500
AA Change: Y524C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210
AA Change: Y524C

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137328
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157544
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene may form a submodule of the mediator complex that magnifies the effects of activators on the general transcription machinery. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die prior to birth exhibiting abnormal heart development, neural tube defects, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,280 W369* probably null Het
Adamts3 A T 5: 89,775,377 M190K probably benign Het
Adamtsl1 T C 4: 86,385,669 probably null Het
Adcy1 A T 11: 7,149,553 I678L probably benign Het
Agtrap A G 4: 148,082,360 S27P probably benign Het
Ankrd24 C A 10: 81,642,545 probably benign Het
Atg2a G T 19: 6,246,814 V383L probably benign Het
Ccdc40 T C 11: 119,259,976 V1105A probably benign Het
Cenpf A T 1: 189,659,533 S684T probably benign Het
Cog7 A G 7: 121,951,221 L360P probably damaging Het
Col12a1 T A 9: 79,700,262 Q428L probably benign Het
Col4a1 G A 8: 11,245,068 probably benign Het
Cpeb2 G A 5: 43,285,756 C930Y probably damaging Het
Cul9 T C 17: 46,543,467 D103G probably benign Het
Cyb5a T G 18: 84,871,564 F39L probably damaging Het
Cyp2d12 T A 15: 82,558,006 probably null Het
Dnah7a A C 1: 53,447,531 probably null Het
Efcab9 A T 11: 32,522,832 I205K probably benign Het
Ezh1 A G 11: 101,216,993 probably null Het
Galnt6 C A 15: 100,693,393 C610F probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Gcc1 A T 6: 28,420,652 I222K probably benign Het
Gm13119 G T 4: 144,362,471 E120* probably null Het
Gm5591 T A 7: 38,522,207 H146L probably benign Het
H2-T23 C T 17: 36,030,366 probably null Het
Hmcn2 T A 2: 31,414,716 I3124N probably benign Het
Hsf2 C A 10: 57,506,221 D364E probably benign Het
Il15ra A G 2: 11,733,205 T250A possibly damaging Het
Large2 T C 2: 92,367,142 E372G probably benign Het
Map2 A G 1: 66,439,010 probably benign Het
Mfsd6l C A 11: 68,557,270 Q316K probably benign Het
Mroh6 T C 15: 75,885,991 T417A possibly damaging Het
Mymk T C 2: 27,062,188 *181W probably null Het
Nup210l A G 3: 90,180,198 T1093A probably benign Het
Olfr120 T A 17: 37,726,377 C118S probably damaging Het
Olfr692 A T 7: 105,369,306 K327* probably null Het
Olfr796 A G 10: 129,607,863 V206A probably benign Het
Olfr921 C T 9: 38,775,956 R234W probably damaging Het
Papola T C 12: 105,826,960 V513A probably benign Het
Pex26 T A 6: 121,185,847 L119Q probably damaging Het
Phldb2 T C 16: 45,747,886 I1219V probably damaging Het
Plch2 A G 4: 155,010,794 V64A probably benign Het
Plekho1 A G 3: 95,995,625 V24A probably damaging Het
Pon2 A C 6: 5,265,455 S311A probably benign Het
Rsrc2 T C 5: 123,739,582 probably benign Het
Selenov T C 7: 28,288,147 D295G probably damaging Het
Serpina10 T A 12: 103,628,816 Y48F probably benign Het
Setbp1 T A 18: 78,856,975 D1159V possibly damaging Het
Setx C T 2: 29,146,983 T1160I probably benign Het
Sin3b A C 8: 72,733,343 probably null Het
Skint11 A G 4: 114,244,845 K352E possibly damaging Het
Slitrk5 T A 14: 111,681,686 V914E possibly damaging Het
Srgap1 A G 10: 121,807,883 Y633H probably damaging Het
Stard9 A G 2: 120,699,358 D2032G probably damaging Het
Sv2c G A 13: 95,981,883 T486I possibly damaging Het
Tesk1 T C 4: 43,447,100 F496S probably damaging Het
Tfg T A 16: 56,712,708 E29D possibly damaging Het
Tnc G A 4: 63,962,096 T2038I probably damaging Het
Tor4a T G 2: 25,194,964 N309T probably damaging Het
Trim69 A G 2: 122,173,340 T257A probably benign Het
Trpm6 C T 19: 18,813,464 A621V probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r6 A C 6: 57,003,194 Q258H probably damaging Het
Vmn2r84 A G 10: 130,385,994 C786R probably damaging Het
Xylt2 T C 11: 94,667,127 D638G probably benign Het
Zfp934 A G 13: 62,517,838 C330R probably damaging Het
Other mutations in Med24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Med24 APN 11 98709682 missense probably damaging 0.99
IGL01960:Med24 APN 11 98707542 missense probably benign
IGL02119:Med24 APN 11 98728835 missense probably benign 0.14
IGL02681:Med24 APN 11 98709739 nonsense probably null
IGL03038:Med24 APN 11 98716184 missense possibly damaging 0.93
IGL03377:Med24 APN 11 98705136 missense possibly damaging 0.67
R1186:Med24 UTSW 11 98717757 utr 3 prime probably benign
R1887:Med24 UTSW 11 98718816 critical splice donor site probably benign
R1888:Med24 UTSW 11 98707282 utr 3 prime probably benign
R1936:Med24 UTSW 11 98718816 critical splice donor site probably null
R2063:Med24 UTSW 11 98715646 missense probably damaging 0.98
R3895:Med24 UTSW 11 98706388 missense probably benign
R4328:Med24 UTSW 11 98707116 critical splice donor site probably null
R4751:Med24 UTSW 11 98706432 missense probably damaging 0.98
R5195:Med24 UTSW 11 98710281 missense possibly damaging 0.71
R6047:Med24 UTSW 11 98707765 nonsense probably null
R6834:Med24 UTSW 11 98705024 splice site probably null
R6984:Med24 UTSW 11 98718542 missense possibly damaging 0.51
R7015:Med24 UTSW 11 98718852 missense possibly damaging 0.51
R7244:Med24 UTSW 11 98714397 splice site probably null
R7479:Med24 UTSW 11 98704961 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TCTGTCCAGGGGAATCAGACAG -3'
(R):5'- ACTTGGCTACTGTGCATGAG -3'

Sequencing Primer
(F):5'- CTAGTGGTCAGCATGAATTTGCCAC -3'
(R):5'- CTACTGTGCATGAGGCCTTCAG -3'
Posted On2016-07-06