Incidental Mutation 'R5232:Ndst3'
ID398591
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 042804-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R5232 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123672239 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 28 (I28N)
Ref Sequence ENSEMBL: ENSMUSP00000118796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably damaging
Transcript: ENSMUST00000029602
AA Change: I28N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: I28N

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137404
AA Change: I28N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: I28N

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154668
AA Change: I28N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: I28N

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172537
AA Change: I28N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: I28N

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,922 E1295G probably damaging Het
Adarb2 C A 13: 8,713,640 H524Q possibly damaging Het
Arhgap26 A G 18: 38,993,476 M1V probably null Het
Atp10b G A 11: 43,202,179 R447H probably damaging Het
B4galnt3 T A 6: 120,232,988 Y58F probably damaging Het
Cdca7l A G 12: 117,870,085 E79G probably damaging Het
Chd4 C G 6: 125,121,310 P350A probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Cubn A T 2: 13,478,202 C244* probably null Het
Cyfip2 A G 11: 46,242,378 S832P probably damaging Het
Dnaaf1 A C 8: 119,590,590 E286A probably benign Het
Emilin1 A G 5: 30,916,979 K188R probably benign Het
Fstl5 T C 3: 76,144,977 W5R possibly damaging Het
Gm5565 T A 5: 146,160,137 Y64F possibly damaging Het
Golga4 G A 9: 118,506,558 probably null Het
Hmcn2 T C 2: 31,457,748 L4802P probably damaging Het
Hnrnpll C T 17: 80,038,678 V385I probably damaging Het
Kctd9 A T 14: 67,724,661 D51V probably damaging Het
Lcn9 T C 2: 25,824,055 probably null Het
Map1a C A 2: 121,301,985 P856H probably damaging Het
Myo5b G C 18: 74,714,932 E1080D probably damaging Het
Naglu T C 11: 101,070,150 I9T probably benign Het
Olfm4 A G 14: 80,021,682 N424D probably damaging Het
Olfr722 A G 14: 49,895,698 Y35H probably damaging Het
Olfr742 T A 14: 50,516,038 V278E probably damaging Het
Phf13 T C 4: 151,992,223 T171A probably damaging Het
Plk3 A G 4: 117,129,120 V605A probably benign Het
Polr3a A T 14: 24,453,211 M1185K probably benign Het
Pramel7 A T 2: 87,489,976 H324Q probably damaging Het
Prpf4b T A 13: 34,883,590 probably benign Het
Pxdn C T 12: 29,990,988 T421I probably benign Het
Sertad2 C T 11: 20,648,344 T180I possibly damaging Het
Sgo2b C A 8: 63,928,602 A399S possibly damaging Het
Skint5 T C 4: 113,577,644 K1043E unknown Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Spock3 T C 8: 63,345,809 F288S probably damaging Het
Srgap1 T C 10: 121,840,911 I393V probably benign Het
Taf6 T C 5: 138,179,952 K429R possibly damaging Het
Vav1 T C 17: 57,303,846 F447L possibly damaging Het
Vmn2r19 T C 6: 123,335,957 M662T probably benign Het
Zfp541 A G 7: 16,095,179 Y1152C probably damaging Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4718:Ndst3 UTSW 3 123672266 missense probably benign 0.35
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGGAACCGGATGGATTCTAG -3'
(R):5'- TAGGAGCGTGCCTGAAACTC -3'

Sequencing Primer
(F):5'- CAAGGGATGAGTACTGGCTCTC -3'
(R):5'- GCGTGCCTGAAACTCCATCC -3'
Posted On2016-07-06