Incidental Mutation 'R0454:Nos1'
ID39860
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Namenitric oxide synthase 1, neuronal
SynonymsbNOS, nNOS, 2310005C01Rik, Nos-1, NO
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0454 (G1)
Quality Score190
Status Not validated
Chromosome5
Chromosomal Location117781032-117958840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117943320 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1196 (S1196T)
Ref Sequence ENSEMBL: ENSMUSP00000127432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]
Predicted Effect probably benign
Transcript: ENSMUST00000086451
AA Change: S1196T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: S1196T

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102557
AA Change: S1230T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: S1230T

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142742
AA Change: S1196T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: S1196T

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171055
AA Change: S1196T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: S1196T

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182216
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGGCAAGAACCCCACAATG -3'
(R):5'- TGAGCTGCATAGCAGGTCGGATAG -3'

Sequencing Primer
(F):5'- ACCCCACAATGGTGGAGG -3'
(R):5'- ATTCTACATGCCGCTCAAGG -3'
Posted On2013-05-23